Description :
From Genome Similarity Track
Location :
Scaffold_228:8924- 15675
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_228-snap-gene-0.30Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_228-snap-gene-0.18Zinc finger B-box domain-containing protein 1
Pytar_ATCC12531maker-par_contig_228-fgenesh-gene-0.12Eukaryotic translation initiation factor 2 subunit beta
Pytar_ATCC12531maker-par_contig_228-fgenesh-gene-0.339S ribosomal protein L24, mitochondrial

Sequence
6751 bases(100 bases per row)
CCATGGAGCGAGTACTCGCCAATGTGGAGCGTCGGCTTGGCCGTGTCAATGCCCTCAATTGTGATCGACTTGTAGTCGTCCAAGATTGGATGGTTCTTGA
AGTCGGCGAGTTCCAACACGACGAGGATCTCTTCTTCGTCCTCCTCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGCCAAC
CATCAGCACCAACGTCTGCCCCGGTTACTCCGCCGTCCGAGTCTTCGCTCACTTGATCACTCGAGTCGCTATCCGCGATGGCGCTGCCGTTCACGACGGG
CTTGTCGGTGGCGTCTCCCGCAGGCGTATTGGACGGCGTCTCTTGCGGGCTATTGGACACCATTCCGTCCGCACTTGGCGCACTTGCACTGGCTTCTACC
TCCTCCGCTTGGAGGCTGGTGTCTTGTGGCGGAGGCGCGCTCTCGGCGACCTCCATATCGTCCGCAGTCCGCTTCCTAGCACCACGCCGTCTCGCCATCT
TTTCGTTATGACTCTGTTGGAAACTTTCCAACAAAACCTGTGCTATAGCATAATTCCCCTCCAATAGATCCTACTTCGCCAACGCTTTGCATTTTGTTGG
TTCGCAATTGATTGACCAACAATATCGCAATTGAGCATCATGGGCGACGACGTAGCTGCCAAGATCCCGCCGGCGGATCCCAAGGAGACCGCGGTCGCCA
TCAAGGGACTCCCTCGCTCTGCGACCGAGAGCGCGCTCATGAACGTGGTCGGCGCCCACGGCAAGATGCTGCGCGTCAAGCTGGACGGGCTGGGCGGCGC
CCACGTGGTGTTTGCCTCGACCCGCGCAGCCCAGCGCGCGGCCGTTTCGCTCAATGGAGCGGTCGTGGACGGCGCGAAGATCACAGCGCAGCACGTGCGC
ACATTTGCCAAGACGACGCGTCCGTGCCGCGGCTTTCAGGAGGGCAAGTGCCGCAAAGGTGACCAGTGCAAGTACTGGCACGGCACGGAAACCGAGACCG
CCACGCCCAAGGCAGCACTCACGGCGCCACCGACCGTGAGTACTGCCAAGACCAAGAAGAAGAACTTAGAGGCAATGGCTGCAGTGGAGACGGCCGCTGC
TCCTGCTCCTGCTACGACAACTCCGATTGCATCCGCCATGGCGGGCGACGACATCAGTGGCATCCCCAAGGCCTCGATTTGCCGCAACTTTGCCAAGGGC
ACTTGCGCTCACGCCGACAAGTGCCGCTATGCCCACGTACTCGGTGCCGGACCATTGCCGCCGCCCGCGCGTGCGAGCATCCCGACGCAGTGCACGTTTT
TCGCAGCGGGCAAATGCACCAAGGGCGACGACTGTGTATTTCTCCACAGTGCCAAGCCATCGGTAGCAGCACCACCGGCGAGCAAGCTGCCGCCACGCTG
TTCGTTCTTTGCGGCCGGAAAGTGTGCGCGTGGAAGCCAGTGTGGGTTCGCCCACGTGCCACCGACACTCGCGGCAACGGCAGCGACCGGACCCAAGCAG
CCAGTGGTCAAGCCTGTCGCGGCAAAGGCCGTTGCAGTGAAGAAGGCCAATTCACCAGTCGTGGAAGCACCCGTGTCTATCCATGGTGGAGAAGAGGATC
GTACGTGTATCGAGTGTGAGCAGCCTGGTACTGCAACGTGGCGGTGTGAAGCGTGTGAGAACGCTCTGTACTGTGACGACTGCAAGACGCTCGTGCATCG
TCCCAAGGTCATGAAGGCCCACACGCAAGAGAGGCTACCGGAACCAACGAGGCCTCCCGTGTGTGGTGAGTGCGAGGCACAAGCCGCGAGTGTCCAGTGC
GAAGACTGTGGCGTGGTGTACTGCGACGAGTGCGACGCGTCGGTGCATCAGTTTAAGAGTCTGCGAGGCCACACACGCTCAGCTTTGGCGAAGAGTTCCT
CGAAGTCGGCACTGGCAACAGAGAAGAAGGTGGCGAACGAGAAGAAACCAAAGAGTGAGACTGTGGCGAGTTCCGTGACGAGCTACATTGAGAGTGTACC
GCAATATGATCTCCCGAGTGAGTCGGAGTCCTCGAGTGAGGAGGAGGAAGATGAAGAACAGGAGATCCATCAGCAATCCGTTCCACAGCGGGCTGTTAAG
CAGACTGCTGCAGTCCAGGAATCCGGTTCGGAGAGTGAAGACGAAGAGGAAGAGTCTCCGGCCGCAGCGGCGATGCGAGCCGCGACGATGGGGTACACCA
AGAGCGTCCCCAAGTATGAACTCTCGAGCGAGTCGGAATCCTCTTCTGAAGACGAGGCGGAAGATGACGACAGCGTCGAACGAGTCGAACTGTCGATTGT
CAAGGCGGCAGTCNNNNNNNNNNCGAAGACGACGACAGTGTCGAACGAGTCGAACCGTCGATTGTCAAGGCGGCAGTCGTCGCACCCAAGCAAGCCACCG
CGACGACAACCACAAAGAACGCGGCATCCAGCAATAGTGACGATGACGACTTTGAAGACGAGCGACCAATTGTGACCAGGCCCGTCCAACCCACGCCAAC
CAGACCAACCACTAGAGTGCCATCGACGATCACCATCTCGTCCGAGTCGGAGTCCGAATCCGATTCTGAGCACGGTGCTGCCACGAAGCCTACGGCCGAG
ACCGTCCCAGTGAAGCGAAAGGCGTCGTCATCAGACTCGGACTCCGAGAGCAGTGACGATGGCGACATCAAGCGCACGCCACCGCCCGTAAAGCAGCAGT
CGCGCATGGCCGCCAAGACCCCCGCTCGCCCGGCCGCGGCTCCAGCTGCCAAGGTGGGGATTTCCACGGGCAGTTCCCACACGCTGGTGAAGGCCATCGA
GGCCTACGCCGAAAGCGACCGCACCGACGTTCTGCATCTCGACTCAAATCTCAACGGCTTTGAACGGCTGCTCGCCCACGACTGCGCCGAGCGGCTCGGC
CTGGATCACGTTAGTGTCGGCGAGGGCCTTGATCGGCACATTACGGTGGCGCGTAAAGGAATGGGGCTGAAGCGAGGCGGAGCTCCTGATGCTGGGGTCA
GGAACTCCACCGGCAAGCGGCAGAAGCGAGCATAGAGGTCCGGATACAGCAAAGGTTTAAAGAGATCCTCCCTCAACAAATAGATTTGTTTCTCTCCTGA
CTTCATTCATTTCTCGGTATCCACGAGCGACCACGTATCCCCCTCCCATCTCCACTCTTCCACACCTCGAGAGGGTACAACACACGGCTACGCTCTTTCA
CACTCTCCTTGAAATCTACTGTAGTTGCCAGAGGCAAGGCACACCCGCCTACGGTGGAAAATCCACCTTCTACTTCCGGGCCGCTCTACGATCGGCACGC
GTGGCAGCATGGAAACCCGTGCGAATGGTCGAGACGGAGCGCGACGAGCCGCACTCTTGGCAGTGGACAAAGTATAATCGGCTCACGCTGTCGCGCGTGA
GCGTCGTGTTTGGCGAGCGGCACATCTGGCACGTCACGTACTCGGTTATGTACTTACGCAGCAGCGACTCAATGTACTTGGGCACAAAGCGACCGCGGAT
CACGAGCCGCTGCGAGCCGTCGATCGAGCCTTCCGTACCCAGTTCGGCGAGCGTGAACTGGAGCACGTGCTCGGGGTTGCGGTTCATCATCTGGCAAATC
TCGGGAAAGTTGACCCACAGCGTCTTCTTCGTACCGACTGTAACAATAGACAGAGCATTAGCACTTGCCCACCATATCTCCCCAGTACATAATGAAGAGC
GCACGTACCTCGCATGACCTGCGGCGGCTTCATGGTTGCGCGCTTGCGGTCCGAGAGCTCCGGGTTGTTCTCGTGGAGCTTCGACATGATGCGCGCGAGC
AGCTCGGCCTGGTACGAGTACGTCGCGGGGTCCTGCACGAGCACGCCCGTAGCGCCAGTGACGACCGTCGACGAAGACGCCGCCGCTCCGGACTCTTCTC
CGCCAGCGTCGGCCCCCTCGCCAGCCTCGTCGTCGTCCTTTTTTTCCTTCTTGACCTTCTTCTTCTNNNNNNNNNNACGCTCCGGATTCTTCTCCGCCAG
CGTCGCCGGCCCCCTCGCCGGCCTCGTCGTCGTCATTTTTCTCCTTCTTGACCTTCTTCTTCTTCTTCTTCATCTTGGAGAGATCAAACATCGCGGCCAC
ATCCTCCGGCGCCGGCGGCGGCGCAGCGCCCTCGCTCTCCACGATCGGTTCCTTCACAGCCAAGTCCGCCATGGTGTCTTGGTGCTGGGTGCTTCTAGCT
TCGAGATGCGCGAGGTCTTCCCCTGAGGCTCACTTGATCGGATTGGATTGATTCCCCACGGGAGACGAAGGTTCTGGTGGCTCTCCGATCCCAGCAGGTC
TGGGTTCCGTTACGACAGGTTCAACCCACCCGTCCAGACCTAGACCCGTAGGAGTAAAGTACAAACCCGACCCATGATAGGCCAGTATTGAAGTAGGCAA
CTATCGTAATGTACTATCTTACGATAGAGCCCTTTATTTAGGTGGTTCAGTGTACAGGGATGTGGAAATTTGAGGTTTTGANNNNNNNNNNGCTTTATTT
AGGTGGTTCACTGTATAGGAATGTGGAAATTTGAGGTTTTGAGGTGCATTCCGGCCGGCAAAGTTGTTGGTGGCGCTTGTGGTGGCGGACGCAATTGATA
CCGACGCGCGACTCGAGCGGATCAATCATGGCGGCGCGCATCCCGTTGGCGTTCCTGCAGGGCCCGCGCCGAAAGAGCAAGCCCATTGACCTCATCAAGA
ACTGGCACATCTTCCGCGGCGATCTCGTGCGTGCAGTTTGCGGCTTGGTCCGGCGCTTCAAAGATCTTCTACGCCCACTGACCCTTTGCGCTTCTTCTTC
TTTCTCAGGTCGAAGTCATCAGTGGTCCGCACAAGGGCAAGCAGGGCCAGGTCGTGCAGGTCGTCCGCGAGAAGAACAAGGTCATCGTCGAGAACATCAA
CATGGTAAGCGTTCAGATCTCCCATCTCTTTTATAATTGGCAAACGCAATTATAATTGACGTCGATTTTTTTTTATTGCAGCACAACCGCTACGTCAAGT
CGACGCCCGCGGCACCGGGCCGCTCGTACCTCGCGCCGGGTCCGATCCATTACAGCAACGTGAACCTCGTGGATCCGTCGGTGGGCAAGCCCACGCGCGT
GGCGATCCGCTTTACGGACGACGGCAGCAAGGTGCGCGTGTCCAAGAAGACGGGCACGATTATCCCCAAGCCCGAGATCCTGAAGGAGCGCCACACGCCG
CGGAAAACAGAGACGGGTCCGTTCGATACGGCACCCGAGGACGCGCTCGAGTGCACGGTCCAGGACTGGGAGATCAACCGCCTGTAGAACGCGATAGAGT
TCCTGTGCAGTTGTGTATTCAATTCCAACAGGATGCTTCACCTCAATTGCGTGAGTGAGTTTCTCTCAGCGCTCAGTACCTGAAGAGCTTCTTTTCTTGC
AGACGCCACTTGATCAAAACCCGCCAAGATTCCAAGGGATCTATCTCTGCTAAACCACTTTGCTCAGCTAAAGATGGCACGGGTAGTCTGTGACAGAGTC
CCTTCAGCTCAGCCCACGAGCTATTCCCAGTCTGGTAGGGATCCATACCACAGCTTTGCCTTCTTGGACTTTACTACCTAGTCGAACAAGGTATCGGAGG
ATGAGGAAGTGAGGCAGGGGGGACGCCTTAGTCCCTCGACGGGACCTCGAGAGGCTCTTCTCTCACGTGAGCAGACCAGCATTGCAGCTTTTGACTCGAC
TCCCGCACCCACTCCACCTTCCCAGCTTCTCGACACACCATGGCGACCCACCACCAGCTCAACGACGAAGCCCAGCCCATCAGCAACGAAGACCAGGCAT
TCTACGACGCCGTCAAGGCCGAATTTGGCGATGCGTGCACGGAAGACTTTTACATCCGCGTCGCGCGTGCGTTCCGCAACACGAAGAAGAATCGCATGCA
GCAAACCATGGCCGAGGCGAAGCGCATCGTCGAGTGGCGCAAGGCCATGGGTGCCGAGACCGTGCTCACGCGGGAGCTCGACCGCTGCAAGCTCTTTTAC
GACTACTGGCCGGGCATGCTCTACGGCGAAGATAACGAAGGCCACGTCATCGCCGTGGATCGCGTCGCCGACATCAACTTGGAGGCGTTCCAGAAGGAGT
TCAACGACGTCGAGCAGCTCATGCCCCACCGGCTCCAGTACATGGAACGTATTCAGTGGGAAAAGGCCGCCATCTCCAAGCGCCTGGACCGCCGCGTCTA
CAAGCACATTTGCATTGTCGACCTCAAGGGACTTGGCATGAAGCACGCGTCCCGCTCGGTCGTCAACTACCTCAAGGTGAGAGGTTCAGTCTCCAAGTGA
ATCACCTCTATTGTCCTCACACTGTGTTGTCTGTGTAGCCCATCTTCGACCTCGGGCAGCTCTACTATCCCGAGACGCTCCATCGTCTCTACCTCATTAA
CGCACCCATGATCTTTGCCGGTGTGTGGAAGATGATCTCCCACTTGGTAGACCCTGAGACCCGCGAGAAGATCCAGGTGCTCAAGGAGAGCGACAAGGTG
CTCCAGATCTTCCAGTCCCACGGCATCCCGATCGAGTCGGTGCCGTCGTTCATGGGCGGCCAGCACCCGGGGCGTCCGCTCAACAGCACCTTCAAGCCGT
CGGTCCCGGACACGCCGCTGCCCGTGGCCGTGCCATCCCCCATGCCCACCGCCTGAGCTTTTCTTCTTTCAGAACCTTCGTAGAAAGTACGCACTCGGTT
TCCTATTTTCAGGCTTCTTTTTCATATAGAGAATCACTGGTGTATTCTCTC