Description :
From Genome Similarity Track
Location :
scaffold_13:8924- 10944
Transcript NameFunction/comments
g792.t1 hypothetical protein PHYSODRAFT_558741
g793.t1 hypothetical protein PHYSODRAFT_543712

Sequence
2020 bases(100 bases per row)
ATCATGTCGATCCACATGCGTTCGCAGCTCTGTACGTATTCCACAAGTCGCTCTCGCTGCCGTATCCCTGTCTAATTGCATTGCACTGCTCGCAGTCCTC
ATTCGCCCGCAGTCCATCAAGCTCGGGACGCGCGCCATGTCTTCGGCCAAGAAGCTGCAGAGCCGCAGCCAGGCCCTGGCGGTGCGGTTGCCGGCGCGTA
CTCTGCCCCGTACGCCGCAGATCGTCGTGGCAGGCGCTGTATTGAGCGCATCGGTGTCGCTGCTGCTTAAGGAGTCGGCACTGTGCCAAGATGCGATGCT
GCTTGCAGCTTCGGTACGTTGAATCTGATCTGAATATCTGCGAGACGTTCGCCATTTAACCACTGCAATCTTCGCAATCTTTAGGAGGGACCATCGGGGA
GTGGAGACCCCAAGAAAAACGACCCGGTGGAGCAGATCATTGACGTGGTGCTGGGCAACTGCGGCGAGCTTACTCTGGCCGGGGGCCTGGGCTTCTGCTC
GGGCTACGCGCTTAAGACAGTGGGGAAGGTTGCGGCAGTGGCTGTAGGCATCGTCTTCATCATGGCGCAGACGGCTGCCTACAACGGCTACATCGACATC
AAGTGGGGCAAGGTGCAGAAGGATATGATCGCCAAGGTCGACCCGAACGGAGACGGCAAGATCGACAGCCAGGACGTCAAGCTCTGGTACCGAAAGCTGC
TCAAGGTCATGAAGACCAATCTGCCGTCGTCCGCGGGCTTCTCTAGCGGTTTTGCGCTTGGCATCTACTACTCGTAAGTGGTTTCTTGTCTGAGTCACAG
CAATGTGGTTGTGACCATTTCGTGACAAAAAATACACATCACATTGTTACAAAATGCTTGAACCGCCCGCCCTACTCGGTTGGGAAGGCCTTTGCTAGAA
ATCCGACGATGATAGAGCGGTCGTCGGCGCTGGTTACACCCATACTCTTAAGTTCGCGCGAGAATGCCGGTACGCTGCTGATCCCGTTGCTGATAAGGTT
GAGTCCTAGTGTGGCGTACAGAATGATCTCGGGCCGGGTGAACGATAAAAATGTCTGCTTGGCGCTCTCGGAGCACGTCGGGAAGCAGTCCTGCCACATC
TTCTCACGTAATCGCGACTTCATGTCATTGTCCGCGACCTGTAGCAAAGACAAGTAAGTTGCAATCTGTTAAACGCCAACCAACCAATTCTTGACCTTCA
ACTAAGGTCGTACCGATACAGGTATGGGTGGAGGCATCTCGACTCCATCTTGTTCTGTCTACAACCATTCCCAAGCACAAATACGTGGCTAGCATCAGCA
ACCAGCAGCTAATACACGTTCATGGCTTGCCGAGAAGGGGTGTGCGTGGGGCCCTACCGACAAGCCAACCTTACGGAGCTCGTGGGCACGGAGATGGAAT
CCCCGCGCGGTCAACTGCGTCGCCTACAGCAAGGACAGCACCAGCCAACCAACGATCACATCCCTAGAGTGGGTATCGTCGCGCAGTGTTTTCTCCATGC
CCAAACAGCACAAAGATCACAAAAAAAAAGTAGATCGTACCGTCGGGTCTTTTTCAATGTAGATCCGGTACGCCTCAGTGGTCCGCAGTCGTGGAGTGTA
CAACTTGGTCTTCCACTCCTGCTTGCAACAGGCAGCACACTAATTAACCAGCGGATTCAAATCCAGAAAACATCCATCTCTTCGCACCTCCGTCTCGTCC
TCGTCGTAGTCGAATTCAATGGGCGCAATCCAGCCTCGTTCCAACAGTCTGGCTAAAATATGTCCAGCCATTCTTGTCCTTGCCTCCCCTACCAGTGTCG
TAGCTGTGGCGGTGGCAGTCGGAGCCGTCGACGCGCTGCCGTCCACTACCAGGTCTGTGTCATTCCTCGTGGTTGTCATTTGCGTAGTGAAGAGCTGCAC
GCCGTCGCGCTCCAGCCACTCCCGCAGTACCGTCTCCTCCATGAACTCCATGTCGTTCTCATCCGACGTCTCCAGTATGCCCGCGTGCTCCAGCAGCACG
ACGAACTCGTCCTCGCTCAT