Description :
From Genome Similarity Track
Location :
Scaffold_788:8922- 10729
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_788-snap-gene-0.4Alkylated DNA repair protein
Pytve_DAOMBR484maker-pve_contig_788-fgenesh-gene-0.1Cytochrome b5 reductase with F-box domain

Sequence
1807 bases(100 bases per row)
CGAGCTGGGTCTACCACGTGCCGCGCTGGTACCGCCTCATGTTCAAGCACTCGAATCCGGACAGCAAGTACGCCGACTGGTTCCACGCTGCGTGGGAAGA
ACACCCGACCAACTACGACACCATCAAGCTGTTCGGCAAGGACGCGCAGATCCACCGCTTCCACCTGGCCTGCGGCGACTTGGACTATCGCTTCTCGGGC
AACACGTTCCACGCGCGGCCGTTCCCAGACGCCTTCTTGACTGCAGTCGTGCAGATGCAGGCGGCCGTCGTGGACCCTGCCACGNNNNNNNNNNNNNNNN
NNNNNGTTCAACCAAGGGTTGATCAACTGGTACCAGAACGGCGACCACTACATCGGGCCACACTCGGACAACGAGAAGATCATTCTGCCTGGGTCGCCTA
TCCTGGCGCTCTCGCTCGGAGCCTCTCGGCGCTTCGTGTTCACTCCACGGGCCAAGCCGAAGAGTTCCACCAGCGTGAGCCCTCCAAGCGATGCAAATGG
ACACGTCATGCTGAAGCAGCCAACTGGACGAAAGGCGGAGCTGCTACTGAGCGACGGAGACTTGGTCGTTATGGGTGGGACGACGCAGAGGACGCACAAG
CACGCACTGCCCAAGATGAAGGCGTGTCAAGGCAAGAGGATCAGCATCACGCTGCGCTGCTTTCGACCGGAGGGCAATCTTTAGCGGATGAATGCTATCA
AAATGGAGTATCGTACATGGTCAGGCGTTTTGCTGCAGGTCTGTTCACGCTGGCCGTTGCTGCTTCTTGCGCAGCGAGCGCGAGTGGAAGCGGTACATCC
AGAGCGCGAACGTGTCGGCCATGCTGCCGAAGCAGTGCGAGTGCGAGAGGCACCACGAGATGCGTCGCCAGCGCGTCACGACCTGCTGCAAATTGCCGCG
CATCTCCGAGTTGGCGTCGTCCGACCCACGCGCCAGCACATCGTCGTGCACGATGAATTGCTTCATCATCTCCTTGGCCTCGGCCGAGTGCTGGAACTGC
TCCCACATGTCGGTGGCGTCTGTGCCAACCACGTCGCCAATCACATGTGGTCCGCCAGGGTGTGACTCGATGAACGATGTCACGTCGTACACCTCGTTCT
CGATCACGACGCACTTGCGATTCTCCGTGACCTGCAGCAGCCGCGCGAGCTCCACGGCGCGCGACAGGCGATGCTGGAAGAAGAACTGCCGCCAGCAGTC
TATCGGGAACACGACGCGGAAGCGGTCGCCGCGCTCGCCAAAGTCGCGCTCGAACACCAGGCGCCACAGCAGCTCGGCCGCGTCGCCCGTCAGCTGCTCC
CACGCCTTACACACCACTGGGCACATGGCCAGCTCGCGAGGTGTCAGGAAGAGCAGTACGCGATGCGCGAGCTCCAGCGGCAGGCTTGCAATCGACCAGC
TCGCCACAGCGTTCTCCGCTGCCGCCGTACCAGGCGCAGTCTCCGTCGTTCGTCCGCGATGGCGAAGCATCTCCTTGCGAGACAACTCCAGAGCGCGCGC
TAGCTCGGCGTCTTCTTCCTCCTGCCGTGCCTCGAGCTTGCTCTTGTTGTTGTTATTGTGCCTCAGCAGCCCGAAGAGTCCGAGGCACGCCAGGAAGCAC
GTGCACTCAGACGACGTCATGTGCCGTGTGGTCTCTCGGCGATACGCCGCCGCCGGGGCCGGTCCATCCTCCTCGCTCTGCTGCTCCCTCGGTGTCGGTG
ACACCGCGGGGAGCTCGTCCTCGTCGATCACGAGCTGGTAGAGCACACAGCACATGGCCGTCATGAAGATGAACTGCGCCACGCGGTTGCCCGTCGACAC
CGGCGGC