Description :
From Genome Similarity Track
Location :
Scaffold_255:89212- 91047
Transcript NameFunction/comments
Phyci_253822Hypothetical protein
Phyci_253851Hypothetical protein
Phyci_253858Hypothetical protein

Sequence
1835 bases(100 bases per row)
TTCTTTATCACTGAGGAGGGCGTATTTACGCTAAATCGAGTGCCACAGGGCGCAACAAACTCGGCGCTCCATTCCAGGGAGAGATGCAGTGAGTGCTGGT
CCCGATGATCCCCCACTCGGCTCTGTTATGGGTGGATGACGCCATTGTTTTCGCGCCTACAGTAGATGAGTTCATTAGTGTGCTCCGTCATTTATTTTCG
CTCGTGGCTGAGGCCATGCTGAAGTTAAACATGGTGAAGTGCTCGCTCTTCACCACGGAGGTGAAGTGGTGCGGTCATCTTATATAGAGATCAGGTATCG
GACATGATCCCCCTTGCGTCGATGCTCTGTCTACGCTTTCTGTGTCAACAACAGTTGCAGAATTGCAGTATCTTGCGCTACCAATTGACTGTAGGACTCG
CTGCCTGACTACGCCTATATAGTTGCTCTCCTCCATGCGAAATTGGTGGCTGAGAAGAAGCGTGTCGGTGGTCGCAGTCGCAACGCACTTAGCTCAGCAA
CGGTGTGGACGGTTGAGGAACAGGATGTGTACAACGCCAGGCTAATGCTAGTACGCGACTCGTCTCTGAAGACTTCGCCAAGTATAGCTCCTCGTCTTCA
CAGATGCCAGCATCTCCGGCTACTCCATCGTGGTTCGACTAGGATCCCTTTCTTCCAGCTGCCCAACAAAAGCACGAAATGATCATCTGCAAGGGCGGCA
CCTTCAAGCACAATGAATGGAGCTGGACAATTATAGAAAAGGAGACATATCCCATCGTCAAGGCGTGTCACGACGTGGAATATTTGCTGCTCCACCTAAG
GAACTGCGACCACGCGAATCTAATCTACATTTTTCGCGCCGCACGAGGACCTCAAGAATCATGCCCGTGATCAACTTCAACGGTGGGCAATGCGCCTTTG
CGGACTTCATTATGTGATTCAGCACATCGCGGGAGAAGACAACGTCTGGGGGGACATTGTCTCTCACTGGCACACGCGGAATGAAACCAATGTGACAGCT
GTACAGACGCGGTGTCGTCCCGCGCTTTCCCGGGTACTAACTTCCCAGCTGCGGCCCCTCTCGGACGGTAATTGTCTTTTCTACGGTAAGCGAGATCTAC
AAGGCCAACTTGGCCGCTGGGCCCGAGCGTGCACGGCTGCAAGTCGCCAGGAGTAGGTGGATGGTGTGGTGATGATTGATGGACGCCACGGGGTCCCGGG
TGGAGAGAAAGGGCTTATTGTACGCCTCTTTGTCGTCGCACATGCTGTAGCACAAGGCCACAGTAGCAAACAACCCATGACGGTCGTACTGCAGCAGCGC
TTTTGGATTGCCCGCTTGGCTGAGAATGTTGTGAAATTCATTCGTGACGTCGTGCTTTTCAAGCATGTCAAGGGCCCCCAGCTGACACCTCGGCCGTACG
GTCCATTAATTTCAGCAACGCACGCATTGAAGTCGTTCAGTGACCTTGGCGAGGGTTTTAGTGGTTTCGTCTATATTCTACTGCTCAAATATGGTGTCTC
TCACTTTTGCGAATTGTTCCGTGCGCCACCCCGACAGTctatgtggcagtggaagcattgatgttgtggcacttgcgctacggtacacctgacacTCTTT
CTCTGATCAAGGAAGACATATCTGCAACGAAGCGATGAAGCAGTTGTCTGCTCGACTCAAAGCAGAGCAGAACGTTACTGCTGTGTACTCACCGTGGCTG
AACGGAACCCAAGAGCGCCTTAAGAAGGATGTCCTCCAGACTTTCCACGCGCCCCTGATGGAGTATTCATTGGACCAATACGAGTGATCATCTTTACTAT
CTGTAGTGCAGTCGAATCTGAGCCACCTTCCTGTG