Description :
From Genome Similarity Track
Location :
Scaffold_11:89200- 92139
Transcript NameFunction/comments
Phypl_g499P-type ATPase (P-ATPase) Superfamily

Sequence
2939 bases(100 bases per row)
ACGTCGCAGTACACGTGGTGGAGTTTCGTGCCTGTGTTTCTCTACCTGACGTTCCAGAAGACGGCCAACCTGTACTTCCTGCTCATTGGTATTTTCCAGA
TCATCCCATCGGTGTCCCCGACAGACGGAGTTCCGCTGCAGTTTATCCCTCTTGCTATCGTGATTATCATTGATGCCATCTTCGCCGGGTACGAAGACTA
CAAGCGGCATATGGCCGACGACCTCGCCAACTCGGCCAAGACGCGAGTATTTAACCACCAACTgcgcgagttcgaggacgtggagTGGCGCGAGCTGAAG
GTTGGCGACTTTGTCAAGGTCGCCAACCACGAGATTCTCCCCGCCGATATCATGATTATGGCTGTGATTCCGGCCGAGGGAGCACGATCCGGTGGGAACA
TGGGCCTATGCTACGTCGAGACGAAGAATCTCGACGGCGAGACGAACCTCAAGTTGCGCGAAGCGACCCAGCCCACCCGGAACATGTTCATgaacgagga
agacgccggGTACATCATTCAGGGATACGTCGAGAGTGAGCTCCCGAACGGCGACATTAACACGTACTCGGGCACGATGTACCTGGAGGAGAACCCGAAC
GGAGGCAACGCCGAGGGGGTCCCTCTTGCGTTGAAGAACATGCTACTACGCGGCAGTAAGCTACGCAACACCAGTTATGTGTACGGCCTGGTGGTAAACA
CTGGTATCGACACGAAGATTATGATGAGCTCCGGCGACGAATTCCCCGTCAAGGTGTCGTCGATCGACGAGATGACCAACAGGCAAGTGATCGTTGTGGT
CGTTATCCTGGTGCTGATGTCGTTTATTGGCGCTGTTGGAGACCGAGTGTGGATGGACGACCTCGTCGTTCCGACGTACTTGCAACTGGACGGATGGGAT
GACACCTTTATCGAGACGTTTGTGTACTTCTTTACGACGCTTGCCTCCATGGTGCCGATCACGCTCTATGTGTCCATCACTCTTGTGAAGGCCCTGCAAG
GATTTTTCATGGAGCGCGACCTTGACATGTACGATGAAGAGAGCGGCACCCCGATGAATGTTCGTAACATGCAGCTGAACGAACAGCTCGGCCAGATCTC
GCACGTTTTCTCAGATAAGACGGGCACTCTCACGTGCAACAAGATGGAGTTCCGTAAGTGCAGCATCGGTGGCCGAAGCTACGGTAAGGGCACGACGGCA
ATTGGGCTTGCTGCTCGCATGCGAAATGACTTCAAGGGCGATCGAACCGTGGAGGAAGAATCCGCAGATGAAAATGACGTCCCGCTCCTGGATGCTCGTG
CGGAGATGCCGGCCCCGAACGTGAACTTTAAGGACAAGTCCATGTGGCGGGACATGCAAAAGAAGAATGACCCTCAAAGCGGAAAGGTCGAAGAGTTTAT
GACTCTGTTAGCATTATGTCATGGAGTCCTGATCGAGCGTCTTGATCCCACTGAAGATGACGCGAGTCCTCCCGTTCACTATTCGGCCTCGTCCCCGGAT
GAGCTGGCCCTTGTCTGTGGTGCCAAGTACTTTGGCTATGAATTTGTCGACCGTGAACCTGGTAATGTCTCTGTCAAGAAACctgacggcgtcgtggacg
tgtaTGATATCCTGGAAGTCTTCGAGTTTGATTCCAACCGAAAGCGTATGTCAGTTATTGTGCAGCGTCGTAAACGTGATGACGAACTTCGCTTGATGTC
GGAGAGTGAAGAGGAtgacgtgctgcttctcacAAAGGGAGCTGACAGCATGCTGTTTCCCCGCCTGGCTCCGATGTCAGAGAACAACTTGCAAATCCGT
GAAGCAACCGAAAAGCACCTGGAAGCGTTCGCTCAAGATGGACTCCGAACGCTGGTTGTCTGTGCAAAGAGGATTAACCCTCAAGTTTGGGAGCAGTTCT
ACGCTCAGTATCGTCATGCGTCTGCTGACTTGAGCGAAGTGGAGGCAAAGTCGCGCGGTGAACCCAACGCTATTGACAACCTTCAAGATCAGATGGAGTC
GaacctcgagctgctcggtgcTACGGCTATTGAAGACCGTTTGCAGGATGGTGTCCCTGAGACCATGGAGGCGCTAGCAAAGGCTGGAATCTGCATTTGG
GTGCTGACAGGcgacatggaggagacggcaATCAACATCGGCTATGCTTGTCGCTTGCTTAACAATGATATGGAGCGACACGTGATTAATGCGGCAAAGT
ACCGCACGAAGGGCTCAATCCTGCGAAAACTTGACAAGATTTTCCACGCCATTCACGACGCAGCCGATGATGCGTCGCGCACATCAACCGTTGCTGCTCA
TTCTGTCCTGTCGCCGCCATCGGGTCAAGTTGAGCACGCTCTGGTTATTGATGGTGCTTCGCTGAACAAGATCCTGGAAGATCCGCTGCACAACTTGCAT
CTTCTGCGTGTGTCGCTACTGTGCAAGGTAGTGGTCGCCTGTCGTGTGTCGCCTCAGCAGAaggcgcagctggtcgagttGGTGAAGTTGAACGTCCCGG
AGTCGCACACACTCTCAATTGGTGATGGCGCCAACGACGTTCCGATGATCCAGAGCGCTCACATTGGTGTCGGTATCAGTGGACAAGAGGGCCTGCAAGC
TGTGAACAGCTCGGACTACGCGCTGGGCCAATTCCGATTCCTCAGCAACTTGATTCTGGTCCATGGGCGCTGGAACTACAACcgcgtcgcggcgctggtt
GTGTACACGTTCTACAAGAACATTGCGTACAATGTGTCCATGTTTTGGTACACGTTGTGGCCGACGGCATACTCCGGCACGATGATTTATTCGGCCTTGA
TCCAGCAGGGCTACAACCTTTTCTTCACCGCGCTTCCTATTGTCGTCTTCTCGGCGTACGACAAGGATctgccgaagaagacagTGCTGGAGTTTCCGGC
GCTGTACCATGCTGAGGTGCGCAAGACTAGCTTCTTTTC