Description :
From Genome Similarity Track
Location :
Scaffold_617:892- 7610
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_617-fgenesh-gene-0.0Voltage-gated Ion Channel (VIC) Superfamily

Sequence
6718 bases(100 bases per row)
CACGCGCGGGGTGTCGGTGCGCACGTCCATCCAGCGGCTGCGTGCGTCCACGTCACTCCCGCCGGGATCCAACTTCCGCTCGAGCATGCTGCGCGGGAGA
TCCAGCTCCATCGAGCTGCTGCTGTTCGAGGTGCGCTCGGCGTTCGACCCGAACTCGCGGGCCATCCACACGTGGCACCAGCTGCTACTCGCCTGCCTCG
TGTACGAGGTCGCGGCGCTACCCTACCTCGTCACGTTCCGCGGAGACGCCGACCACTGGCTCACGCCCGAGCTCGCCGTGCTCTACGCGTGCGAGGTGCT
CTTCCTCGCTGACATCTACGTCGAGCTCAACACCGGCTACTACGAGGACGGCAACGTGACGCGGGACGCGTCCAAGTCTCGCGTCAAGTACCTCAAGTCG
GTGCGGTTCGCGCTCGACGTGCTGGCGCTGCCGCCGCTGTCGGTGCTGCCGCTGCGCCACCTCGGCTTCTCGCACGTCTACCTCGAGCTGCACAAGCTCG
TGCGCGTGTGGCGCATCCCCAAGTACATCGCGCTGCTCGACGACCTGTACGCGCGCCACTTCGAGCTGCTCAAGATGTGCAAGGTGCTGCTCGTCATCCT
GCTACTCTCGCACTTTGTCGCGTGCGGCCGCTTCTGGTTCGGCTACGACGAGCACGGCACGAACCACTGGCTGCCGCACCGGCCAAGCCACGACCACGAG
CAGTCGACGCGCACCAAATACCTCATGTCGCTCTTCTGGGCCTTCGGCATGCTCACGGGACTCTTCGAGGGCGAGCTGCCGCACGCGCACATTGAGTTCT
GGTTCGCCATGCTCGTGGGTCTCTGTGGCTTCTCGCTCTTCACGTACCTGTGCGCCACCTTCTTCATGATATCCAAGTGCGAGAGCTCGCATTCGGAGGC
GGCCGAGGCGCGCATCAACCAGCTCAAGCACCTGCTCTCGTTCCACCACGTGCCCGAGCCGCTCAAGGAGCAGGCCGTCGAGTACCTCAAGCGCTACTAC
ACGCACTCGGAGGCGAACGACCGCGAGGCGATGCGGCTGCTGTGTCCGTCGATCGCCAAGGACGTCCGCGTGGCGCTGGTCAAGGACATGGTCGCCAAGA
TCCCGTACTTTGCCCACTGCAACGAGCAGTTCATTATTGCCATCACGAGCCTGCTCGAGATGGTCTCGTTGCCCGCCAACTTTGTGCTGTTCAACGAGGG
CGACATTGGCGACTCCATGTACCTCGTCAACTCGGGCGTGCTGCACGTCGTGGTGGACGGCATCAAGGTGCGCGAGGTGCGCAAGGGCCACGCTTTCGGC
GAGATGAGCATTTTCCTCGACCGCCCGCGGTTCGCCACCATCATCACGACCACGTACTGCACGCTCTACAAGCTCGCGCGCTTCCACCTGAACCGTATGC
TTGAGGGTTACCCGCAGTACGCGGCATCGATCCCGAACAAGGTCGAGGAGATGGCGCAAAAGCTGTTCGGGAGGCATGTCACACGCGCTTCGGCGACCGA
CTTGGCTCGACGCGGCTCGCTGGCGGCCCAGGGCAAAAAGAAGACCATCACGTCGCTCATTCGGAAGCACGTGCTCAAGGAAAAGGCCAAGGTCGCGCCG
TCGCCGTTTCTCGCGCTGGTGTCGTCGGCCGTCGCATCCTCGCAGGCCAATGCAGCCAATGCAGGCAGTGCAGCCAATGCAGGCACAATACAGGTCTCGC
TTGGATCGACCACAGGATCGGGCAACTCGACCAAGTCGATGCGCATGTTGGTTCGCAAGTCGTTGACCGCACGCGCGTCGCTCTCACAGCCACAGCCGTC
GCCGACCCAGCCGAACAATGACAGCGGGACTTCGGCAGCACCAAATCCGACCAAGGATGACCAAGGACCCACCACTGCGGGTCTGGTGGCCCCGGCTGCG
AATGCGATGGCTCCAACGAATGGTCAAGGCGAGGGCAGCATTCATCAGCGCAACTCATCGCTCCTGATGATGGGCCAGGCGCTGTTTGATCATTTGATCC
GCAAGCCATCAGCGAATGCGCCGTTCTGGTCGCGGCTGCTGTTGCCGCGCGCCATCGATTTCGAGAGCCGGCGACGCATGTGGTGGCTGCTGTCGCTGCA
GCTCGCGTGGATGTACAACTGGGCCGTCGTGCCGCTCTTCCTGAGCTTCCGGCTGCTCGACCAGCGCTTGTGGGTCGTCGAACTCGTCAACACGCTCATG
GACATGGTGCTGTGGGCGGATGTGTACGCCAACTTCAACCTTTCGTTCGTCGAGAACGCCGAGAAGATCGTCGACACGGTCAAGACAGCGCGGCGGTACG
CGCGTTCTCAGATGGCACTTGACGTGGCATTGGCACTGCCATACTCGCTGGTCCTGAGACACTGGCTTCTACGGCCAGAGCTCGCGCGTATCCCGCGACT
GCTGCGCGTGTGGCGCATCCCTAGCCATTTCCACGAGGTCGACGCGTTCCTGCAGCTCTCGAACAAGCAGCGGCTCGCGCTGCTCACGGTCATGCTCTTC
GTGCTCTACCACGTGGTCGCGTGCCTCTATTTCAGCGTCACATACCTCGAGGGCTTCAGCTCCGCGGAGGATTCGTGGCTGCCGTCGCACGACCTGGAGC
TGCACCGAGTCAACGCTTCAGCGTATGTGGATGTGTACAACGAGACGTACGCGGCGGAGGACAGCGTCATCGACGCCATCGTGGCCAAGCAGTACTTCCG
CTCGCTCTACTACGCGTGCAACGTGCTGACGGCGCTCGGACGCACGATCGAGCCGGCGAGCGACACGCAGTATTGTGCGGCGCTCGTGTTCATGCTCAGC
GGCTTCTTCATCACGGCTGTGGCCGTGGACATTGTGCAGAAGCGCTTCACGGCGTCGGCGCTGGAGCAGAAGGAGTTCTTCTCGACGCGCTCGCGCATCC
AGATGTTCCTCCGACGCCAGAGCGCGCCGCTCGCACTCCACAAGCGCGTCAGTGCGTTCCTCGACTACTGGTGGTCGGCACACCGTGGCGCCTTCATCGG
AGGACTGCTCGAGGAGCTGCCCGAGACCATCAAGCACGACATCATGTGCAGTATCTGTAAGCCGGCGCTGCAGACTCTGACTCTGCTTAACGGCGTGCGA
CCCGTGTTCTCGGATCTGGAGCAGGTGTTCGTGGACAACATCAAGTTCATCCTGTACGGCCAGGGCGAGACCATCTACCGGCACGGTGACTATGCCGGCG
GGCTCTTCTTCCTGCTGCAGGGCGAGGTCGGCCTCATCCTGCCTGGGTCGCCGCCACGCAGCATCCCGCCTGGAGGCTTTTTCGGCACGGCGGCGCTGCA
GCTCCAGGACGACTCGGCCAGCTACACCGAGCGCACGACGGCCGTCTCAGGCTGCGTGCTGGTCTTCGCTGCGCGCGAGCACTTGCGGGCCATGCAGCGC
AAGTTCCCGACACTCGTGACGGCGCTTGGCGACCTCGAGAAGCGCTTCCAGGACCCCAAGCTCGCCAAGGCATCGACCATGGCCAAATTCGGGACGATGT
CGTCGTCTAGAGGAGGTGGTCAGTCACGCTGCTACCGCTACTTTGCCGCGCTGCGCGACGTCGTTTTTGACCCGGACGCTACCCTCATGATTGCGTGGGA
GACGTGGGTCTTCGTGGCCATGACGGCGCAGTGGGTCTCGATTCTGCTCCGCGTGTGCTTCGAGGTGGCCTCTGAAAGCTTCGTGTGGGCCGAGACGCTG
CTCGTGCTGCTCGAGCTCAGCTTCCTCGCAGACATGTTTATGCGAAGCCACCTGGGCTACTACGAGTTTGGCAACAAGATCATGGATACCAAGCTGCTGC
GGCGCAAGTACTTTCGGTCACCCGAGTTTGTTATCGACCTCGTGGCGCTGCTGCCGCTCTTTGTCATCTCCTGGGGACTGGCGCCGCCGACGGCCGCAGC
GCGAAAGCGCCTCGAGCTGCTCAACCTGAACAAGCTCGCGCGGCTGCTCAAAGTGCCGACCCAGTTCACCGCGCTCGAGAACAAGTACATCAAGTACACC
CTCGAGCTGCGCGTGTTCAAGCTCGTGTACTACACGTTCCTGCTCTCGCACCTGTTCGGCTGCGTCTGGTTCGACTTTACATCGCGACACAGCTACCATC
ACGCGGTCGAGACGGGGGAGGAGCTGCACAAGTGGCTGCCATCTCCGTCGCTTCTCGAAGGAGACACGGCGCTCCAGTACTTCGCATCGCTCTTCTGGTC
GTTCGGGCTCATGTCGGCATCCAACCCTGGCGAGCTGCCCAAGGACGTGGCGGAGTGTCTGTGCGGCATCACGACCATGACCTGCGGCTTCTTCCTCTTC
GCATACGTGATCGGCAACTTCTCGGACATCATCGACCTCATGGACGCTGAGAATCGCGAGTTCTACGCCAAGCTGACGTCACTGCGCCACCTACTGGCGC
ATTTTCAGCTGCCTGTGTCGACCCAAGAGCGCTTCAAGGCATATTTCTTCTTCAAGCGCTTCCACTCCATCACGCAGGAGCACCTGCTCGAGCAGAGCCT
GCCTCCGTCGCTGCTCACCGACATCCGCATGGTGCATTTGCAGCCCATGATCATGAAGGTCTCGTTCCTCGCCGACATGGAAGGCAGCGTGACGCGGATG
CTCGTGTCGCAGTTCGGCCAGGTCATGGTCGTCAAGGACGAGTTCGTCTACAAGTTCGGCGAGAGTGGCAGCAACATGTTCTTCGTCTTCGCTGGAGTCC
TCGACTCGCTGGTGCCGCGCGACGAGTTCATGCGCGACACTTCCGCAGTCGAGCCGAGCTTGTCCCGCACTGCACCGGACGACGCGATCAGCCACGCCAC
TTCAGACGATCGTCTTCAATCGAGTGACAACCTCGTGGCGGCGCAACCTGACCAGCGGCATCACGTGAGACCTCCTATCCGGCCGTCGCCGAAGATCCAC
CCCCGGCCACAAAACCTGAAGAGCGGTATTGACCTCAACACTCTCACCCAGCTGAATCGGATCGAGGCCGGCAGCTACTTTGGCGAGAACGCGTTGTTCG
ACAACTCAGCGCGCAAGTCGTACGTCGTCGCGCGGTCGTCGTGCATCCTGTACAGGTTGTCGCGCAACTCGCTCGAGCTCGTCTTCAACCGGTACCCTGA
GTGGAAGCAGAAGGTGCTACGCATCATGAAGGTCCAGCAGGAGCAGCACCGACTCAATCGTATCGCGCACGAGGAGATGCTATCGATCGCCACAGGCATG
GAGGCGCACGGAGAAGACGAGCTGTCAGCCGAGCGCACTGAGGGGGAGATGCTCGGCAAGCGCGGCATGCGCTCCAACACCTCAGTGGGTCGCAAGGCGA
GCGTGTCGCCCCGGTTCCTCCACGCACAGCAATCGCAAGAGCTCTGGACGTACTCGCCGCGCAGGCTGCTGCGGCTGCCTGGTCATTTGATCGCTCTGTT
TCGTGGTGTCCCCGCCCAGAGCTGGCTCCACCTAACGTGGCTCAAGCTCGTGGCCGCCACGACGCTCTTCATGGCCATTCTGGTGCCCTATCGCATCTCG
TTCGACGCACTCAATCGCGCACAAGGTGGCGCGGTCATGCTGCGCGAGCTCGAGACCGTGTTCGAGTTCGTGTTCGTGGCCGACATGTGGGTCAACTGGC
GACTGCAGCGCAGTGCCGAGTCGATGGACCTGTACGAGCAGGATCACCGCCAGGCATACCGCAAGGAGCGGCTACGCTGGGACGTGCTCGCGGCGCTGCC
GATCGACTACCTCGTCAGCTCGTTTTCGCCCCACCCAGTCTTCAGGCTCAACCGGTGCGTCAAGATGCGCAACCTCGTGCACTACCTGCACGAGCTGCAC
CGACGCAGTCTGCACAACGAGATGCACCGCCTGCGCACCACCTTTGTGCTCTACCTCGTCTTCATGTACTGGGGAGCCGCCATGTACTTCGCCGTTGCCG
TCTACGACCACTTTGGCGACGAGTGGAACGCGTGGTTGCCCGACAAGACGCTGGCTGACCCGGAGCTGCGGTCGCTTCGGCTTGTTCGCGGTCTGTTCTT
CGCCATGACGGCCTTCATCAAGAAGGGCCGCACGTTCACGCCGGACTCGACGCCGCACTTCATCTTCACGATCATCACGTGCTTCATCGGCCTGCTCATC
ATGGCGTTCATGATCGGCGAGTTCGCCAATCTCTTCATCTCGTACATCGGCGACGAGGTCGCGTATCGCAAGAACTACATCGCCGTCGAGCTGTACGTGG
CGCGGCGCAAGCTCGCAACGCCGCTGCAGGCGCGCATCCAGGCCTTCATGTCGTCGCTCTGGTCGTCGCACCGCGGCATCGACTACCAGGCGCTGCTCGA
GGAGGTGCCGCCGTCGATCCGCACCGAGTCGGTGCTCAACATCGCCGACCTGCCGCTGCAGGCGTTCGTGGACGACGTCTTCCGCCCCATCAACCGCCCT
GACCCACCAGGCTCGGCCAACGAGCTGACCCAGGCCGTGGCGCGCCACCTCAAGTTCGAGGGCTTCCCGCGCGGCGAGGACGTGCTCGTCGAGGGCTCTA
TCGCCAAGTCCATGTACTTCGTCGTGCGCGGCGCGCTGCACGCCGCGTCCAGGTCGCACCCGAGCTTGTTCCAGGACATGACGTTCACCAAGGGCGACTA
CTTCGGCGAGAAGGGGCTGCTCGGATACTCGGTCGGCGTCTTCTCGGTGCGCACGCTGCGTGCATGCGACCTGCTCTCACTGCGAGCAGAGGGGCTGCTG
CAGGTGCTGCGAGCCCAC