Description :
From Genome Similarity Track
Location :
Scaffold_2075:892- 4764
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2075-fgenesh-gene-0.0Syntaxin 7
Pytar_ATCC12531maker-par_contig_2075-snap-gene-0.5Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_2075-snap-gene-0.6Gene of unknown function

Sequence
3872 bases(100 bases per row)
ATGGGGGAGCGCTACATGAGTGCCGACTCGCCGAAGGGCGGCGGCGGCGCCTCGGCCGAACGCTACAACAAGCTCGTGCAGGAGACGTCCAAGGGCATCT
CGAGCTTCAACCAGCTCACGCGGTCCATGGCCCAAAAGATGTCGCTCTTTGGCACGCCGCAGGACTCGCGCGCCAACCACGAGCAGCTCAAGGAGCTGTC
GGAAAAGGGGAACCGGATTGTCACCAAGATCAACAAGCGACTGCTGGAACTCAACAAGGCGTGCCAGGGCCCGCAGGCGCGCGCACGCAAGACGCAGGTC
GCCAAGCTCTCGAACGACTTCAAGAACCAGGTCAAGCAGTTTGAATCCACGTGTAACAAGCTCATGGAGTCGGAGCGCCGCAGCATTGAGCACATTCGGC
GGTCCTCCCAGTCGTTTATCGATACGAACCGAGGCGGCGGAGGCAATCAAGGCGGAGGAGGAGGCGGTGGTGGCGGAGGCGGTCTCGATCTGAATAACTA
TAACGAAGACCAGCTCTACGCGCAGGCCAACATCATCCGCTACGACGAAGACGGTATGTGCTCCCGCGATAGCGTCTGAATGAGGAACGATACTCATCTT
TGTATGCGTTTTACCCCGAATAGATCTGGCTCGACGAGAAGAAGACATTCTCCATATCAACCACCAACTGAGAGAAGTCAATGCGGCCTTCCGAGAGATC
GACGAGCTCGTGCAGGAGCAGGGCGAAGTCGTCGGTACGTGGTTGTCCCCTTGTCTTACTATTTAATCGGCCCGATTAGCAATTAACGGGATCCACTTTT
TTTCGTTTCACTAGTCGAGATTGAGCAAAACACGGAAGAGGTCAAAGAGACTGTGAGCAAGGCGAAGGAAGAAGTGGCGCAGGCCAACGCGCGCAAGTCG
TACTGCGTCTGCAACAAGCGCAAGATGATTTGCTACGGCGGCATCGCTCTCATCCTCGTGCTCATCGTGGTCATGCTGCTCAAGACCGTGCTCTGATCAG
CGCATGCTCTATCACTATTACTCGATCCGCGGCTATTTGAACGGACGATCGAAGAACATATTCCATGTAATTGCTTATCCTATTTCTACTACTACGGTAG
TAGTATTCTCCAGTGTATTACTTTTACCCCTCTTCAACCCGGCGCTTCACGGTGGCGCCGACCTCGGTGACCAACTGCGAGGTTCTCCGCTCCAGCCGTT
CGGCCTTTTTCCGCGCCTGGAAGATACTGCCCGCGACCGACATGNNNNNNNNNNNNNNNNNNNTACTGCCCATCGACCCGGCACTGTGGCGTCGCCGATT
GCGATTTCGGCCAGTCGTCACGCCACCAATTTCGGAGCCATTGTCCTCTATACCACCACGCATGCCACCCGTGCCGGTCGACGACGCCGAGCACGTCTGC
TGACCAAGCGAGCGGAACCGGTTCCGCACGTCCACGGAAAACATACTGGAAAATTTGACGTGCTCATCTCGCACCGACGAGTCAAACAGGACGGCACACG
TGCGGTCCTGCTCTCTAACGGCCTCGACCCAGCCGTAAAAGTACTGGATACTATTGTGAACCCGTGCGAGCACGGCCTCGCCCACGACAAACGTGACGGG
CTGAATTTCGAAGCCGATCGTGTCGAACGTGTAGTTGGTGAGCTTTTGTGGAGGCGGGAGTGCATCGGGATCGTCAATCTTGGCAATCTTCTCGGCTGGC
ACACGGTCCTTCTGCTCGCCATAGTCAAAGACGACCGTGTACAAAGTCTGGCCGGCCTCGGACGCCTTGGCCGCGATCTTGGCCGAGCAGTACCGCATGA
ACCGCGCGCTCCATGCGAGCACGAGCTCACCCACTTTGGCGTCATGCAAGAGAGGCGGCTTGTCCATGGTCGCGTCCACGGCGTTTGTATCCAAGATCAT
TTGCGACGGGAACACGCCAAACGCCATGGTCCCGTCGGCAAACTTTAGATCGCACGCCGAGCTTTCGTGCTTGCGGATCACGACGCACGTCTCGACCGAT
GCCCGCCTCGGGTGGTCGGCCTTGACTTGGTACCCGACCTCGACCTGGAACCCTCCGTCGGGACTCGCCGACGCGGCCTGCATGAGCACGGCATTCTTGA
GCGAGAGCAACTCCATGTCTTCAATGTGTGTGACGCGCTTGCGCTTGGTGATGAGCGCGGGCGCAATCTCGTAGCCCGTCGAGCCATCCGCGAAATCGAT
GGCCGCCGTTTTGTTGGAGTAGACGCCGTTGAGCACACCCAGCTTGTCCTCGATCTGCCCCTCGTACTCGCCCTCGCACTTGACAAAGACCTGGTCGCCT
ATGTGGACCTTAATCTTGCCGCTACAAATCAGGAACTGGTCCTCGGTGATGCGCACGGGTTCCTTTTTCTTTTCTTTCACGGGCGCAATCTTGTCAGCGG
GGACGTTGATGAGCCGAATGCGATTCTGGAGCAGCACGTGGAACATGGAGACCGTCGTGGCATTAACGCCTGAGGGGGAAGTATTGCCCACTTTCACTGT
ACTGTCCTCGAGAGTGATGACACCAGTGCCCGAGAAGCGCGTGCCGGGGTACAAATTGACTTGCACTTTGCGACCAGCGTAGAGCCGTCGGTTCTGCTCC
TGAAGGTCCAAGATCTGCGCATCGAGATCCTGAAGGGAGGGCAAGAAATCCAGATCTTTCGCGGGCAAGATCTGCACGGCGATGGTCTGCTCGACCTCGG
CGACCACCTCATAGTCGCCGTTCGGGAGCCGTGACATGACCGAACCATAGGCGCGCNNNNNNNNNNNNGCACACCGTCGCTCTCGCGCTGGAAGACGACC
CGCGTGCTCGTCGGTGAGACAGTCATCGTCGACAGCGAAGGGCGCGCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCG
CAGCAGCTGAGGCACTGCGATCTCGTCCCGCTCCGCCAGCCGCCGAGTTGAACGTGCCTGTCGTGGAGCGGGATCGCTCAAGTCGTCCCGGGCCACGAGG
CGATACTTCTGTTTGCTGACCGCCGGAGAAACTCGTGCGATATGTCGTGCCGCGGCCATTGCGGATCGCACAAATGTCGTCTCGCCGGATCTCCATTTTG
CGAATCACCTCACTCATCGGGTCCATATTCACTGTGGATGGCTGCACCTTTTTCGTCTTCTTGGCCAGGTAGTCCTGAATGGTCTGCTTGATCCCCTTTG
GGGACGGCAAGATTTGGTTCATGCTCTTGCCTGTCATGGAGAGCCGATCGATTTGGGAGAGCGACGAGATACTCGAGCGTCGCGTGGACGCGCGGTTCTG
CTTGTGGTGGCGGTGGCCGCCGCCTCCTCCCCCTCCAATACCAAACGTCTGCGTCATTTGCTGCCATGGTGTCATGGTCATGTCTTCCTCGCTCGACTCG
TCCGAGTCGCTGACTTGGGTCGAGTCGTCCTCGTATGCAACACCGCACTCCAAGTGCTTGACGTCGAGCCACGCATTGTCGTCTACATCGTAGCCGGCGC
GACCGGCGCTGACCTGACGCGGTGGTGAGACCGAAAAGTCCACCATGACCGACTTGTCGCCCAGATGGACCTCTTGGCGATACCACGTAATCCGGTGGTC
ACTTCCACCTTCCTCACCAGCGTCTTCCTCGTCGAGCGTATCGCTATCGCTACTAGCAGTTCGAACCATGGGCAGTGGACGGAGCACGATATCGTCTCGC
TTCACACGGTAGTTGAGCGAGCCGTCGTCAAACACAATCATGAAGAGCCCGGCACCCAAGTACGTCGCAATGTTGCCCGAATAAAAGTACGGCGTCCGCT
TATACCGCGCCAGCACAGCCTGGCCATAGTGCCATTGACCACGCAACGGCTCGTAGTGTGGCAGCTCTTGGA