Description :
From Genome Similarity Track
Location :
Scaffold_1746:892- 2910
Sequence
2018 bases(100 bases per row)
AGTACCACGTCGACGCCTGCACTATGCGCCATTACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGC
AAAGGTCAAACACCTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTG
CCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACG
AAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTGCCTCCACTGACTCCAACTCCACGTCTCGTGCTCCATGTTTGTGGAG
CACTTGCACTTGTGGCACGGGCGATCTCATACCCTGTTCGGCCAGGAAACGACTCATCGAAGCTTCGAAATGTTGCTGCAGGGTGCCCGAGGAAGTGTCG
GAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATC
TGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGACCCTCGCCCG
CGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGAC
GCAGCTTGGCTGATCCTCGGCGAGGACACTGGATCCATAGTGCGCGACCTTTCTCCAGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATA
CTATGAGAGCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCAC
CAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCGGCATGACAGGATCTTGATGCAGGAAG
TCGCGTAACGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCGACTCTGCTTGCATCTTCTT
CCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCA
TACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACGCAAGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTT
TCTCTTCTGAATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCACGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGA
TCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAGATCCCGAGTCACCAAAAGATCCGGGCACG
CGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCTAGCTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGA
TGATCCGTGTTCTGCTGAACTTTCCTTACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAATCTTG
AGTTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGCGGGTTGTTCCGAATCCTAAGCGAATATTCGAGCTTAT
GGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGCTCCTTTGCGTCGTACTTGCCTCCTCCTGTG
ACGGGATCTTGAGAGTTG