Description :
From Genome Similarity Track
Location :
Scaffold_2255:892- 2556
Sequence
1664 bases(100 bases per row)
CTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGATGATTGTATCCCCGTACACATCCGTGTA
CTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAG
ACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCGGCGTTCCCCTGTCCCCGGAATGCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCT
TGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCAACTTCCCACAGCTGAAGCAGCGGATGTCACGCTGTTCGGCGGA
CCCGAGTTCCATGGGACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGC
TGTATTCTTCCTGAAGAGCCACTTGAATCGCCTCTTCAAGAGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGTCCAT
GAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCTTGTATCTCTTGCACATACTCGTGCAGTTCGCGTCTCCCT
CGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAAC
ATCCAGGGGATGTCGCTTCCCGAGTGTACAACCAACTCTTAGCACGCCCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAG
AGCCGCGTCCATCGCGGAGCTCTACTTCCCCGGACCCAGAAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTTACCTTCAGCCGTATTGGCTTC
GGGTTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCG
AGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGTGTCGTTCATAT
GGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGAAGAGGTTCAGGTACTGTAGTCTACCCGCGGTGGCGTGGATTGACTACGAGTGCTACCAGGTGT
GACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTACCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGA
GAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTAATACAAACTATAAGTTACCTATAGAAATGCA
ATGTCGTTTGACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCCAGGAGTACTTCTCCGGCCCGTTTCAAAATGATGATTGGGGTTT
TTTATTGATCGCACATAACTGAATAATCTACTTCAATTGGATAAAAAAGACCTTGGTTTTGCAT