Description :
From Genome Similarity Track
Location :
Scaffold_1892:892- 2426
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_1892-abinit-gene-0.6GJ22538

Sequence
1534 bases(100 bases per row)
TACACTCCGCATCAAGTCTTTTCGTATACTACTTTTTTGTCGTATCTCAGTCAATTTTAGGGGGTTTGAGCGTGCTGTTTAGATATGTTGCTCCTCTCAC
GGCGGCGAGAGTGCGGTTGTCGCTAAAACGCCAGAATTAGCTCTAATTCGAGGGTCTGGCATACAAAATATCGATTTCAGTCCTGCGACAAGTGTTTCGC
ACGCCACTCATTATACAAATTTCAACATAAAAAGAATGATGTAGAAGGGATTTATTTTTAGTAATGAATCTTGTTGCCTTTCTTCTCAATCACCTCAGCA
CACCGATGCGGCATGAAGTCGATGGACGCTCGTAGTACGCTCGTCTCGATTGATTCCCATGCTTGTTGGGCCGCTTGAGTAAGTTCCCCCACGCTGTCGA
ACTGTCGTCCGTTAGAGTGGACTCGCTGGGTCATGATAGACCACAGGTTATCGATTGGGTTCAGATCTGGAAACTGCGCCAGCCAGTCGAGCACCCCAGC
GCCCTGCTCTTCGAAAAACTCCTTAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGGCGAATGGGAG
GAGGAACCCAGACAATGTGTGTACGTAATCGCCAGAGTTCTGCCTCCCATTCAGCACAGCAAGTTTTGTTTTTCCAGCTGCGCTAAACCCGCCCCATACC
ATAACCGACCCTCCACTGCCTTGGTGTCGCTTTGCCTGCCGAGGTGGCTTGCGGAGATCTCGCCGGTAGTACTGAAAGCCGTCCGGTCCGCCCAGGTTCC
GCTTCTTCTCGTCCGAGAAGATGATGTGTTCCCACAGGACGGACTTTCGCAGTAGCATCTCTTACGCCCACGATTTCCGCGCGACCTTGTCGGCCTTGGT
CAAGGGAAGAGTGTTTTCCATTTTGGAGTACATGAGCCAGTAAACGTTGGCGAGGATTTGCTGTATTGTACGGACGGACGCTTCGAANNNNNNNNNNGAA
TTTGCCCGTCACAACAGTGCGGACCAGCAAGCAAGCGTCGCGTTCAGATAGCAAAGGAGCCAGCCCCATTCGCTCGCACTTGACGCTCTCCACCCCCGAA
AGAACGCGCCACACCGTGTTGGGGGCCCGTTGAGCTCGCTGAGCGATCTTGCAGATGCCCGCCTTGGTCTCCCTGAGCCCCTTGATGCAGCTGCGCTCCT
CGTCAGCGACAAAAGCTCTCCTTCCCATCGTCTCTCACAACGACTGCCACAAATTCATTACTAAAAATAAATCCCTTCTACATCATTCTTTTTATGTTGA
AATTTGTATAATGAGTGGCGTGCGAAACACTTGTCGCAGGACTGAAATCGATATTTTGTATGCCAGACCCTCGAATTAGAGCTAATTCTGGCGTTTTAGC
GACAACCGCACTCTCGCCGCCGTGAGAGGAGCAACATATCTAAACAGCACGCTCAAACCCCTAAAATTGACTGAGATACGACAAAAATAGTAGTATACGA
AAAGACTTGATGCGGAGTGTATGTAGCCGCTGCC