Description :
From Genome Similarity Track
Location :
Scaffold_832:8919- 11943
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_832-fgenesh-gene-0.1ATP-binding Cassette (ABC) superfamily

Sequence
3024 bases(100 bases per row)
TACGCGATTCTTGCGACCAAGTCAGCGATCGACGCGTCTGCCATGAACGCTGGGACCACGCCCGACACGTGTGAAGGCCGCATTGAGGCCGTGGGGGTCG
AGTTCTTCTACCCGAGTCGCCCCGACGTGACGATCTTGAAGGACTATAACGTGCGCATCGCGCCGGGCGAGACTGTGGCGTTTGTCGGTGCGAGCGGCGG
TGGCAAGAGCACGTTGATCGCGCTACTCGAGCGGTTCTACGATCCGATCCGAGGTCAAATTCTGCTAGACGGGCGCGACATCACAACGCTCAGCGTGCAG
TGGCTGCGTGCCCAGATTGGATTGGTATCCCAAGAACCTGTGCTGTTTGCGACGACGATCTTTGAAAACATTGCGTTCGGCTCGTCTCACGGCGTCACGC
GCGACGAAGTGATCGCGGCCGCCAAGCTCGCGAACGCCCACGACTTTATCATGCGCTTGCCACAGCAGTATGATACGACAGTCGGTGAAAAAGGCATTTC
GCTCTCTGGCGGCCAGAAGCAGCGCGTCGCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
CAGCCATGCGAGAAAGCTTCGTGATGCCACTGTCCGAGGCCACGCTCGCGCCGGTTGTCCAAGCAACTGCACGAGNNNNNNNNNNACGCGTAGTGCAGGC
GGCGCTGAACGAGCTCATGGCCAAGACTCGCATGACGACGCTGGTCATTGCCCATCGTCTCAGTACGATCCGCAACGTCGACAAGATCGTTGTTCTTGCG
GGCGGTGGGGTCGTCGAAGAAGGCACTCACGATGAGCTAATGTCGATCCCAAGTGGTCTCTACAAGAATCTGTACAAGATCCAGGCCGGCGCGGACGAAG
ATGACGCTACAGCCATGCGAGAAAGCTTCCTGATGCCACTGGCCGAGGCCACGCTCGCGCCAGTTGTCCAAGCAACTGCACGAGGCTCTGACGATGCGTC
CGACGCTCCGGCCGTTGGTACGGCACGACACAATGAGGCGGCGGCTCCTGTCAAAGCATCAAGCTTCACGCTGCGCAAAGCCATCGCGCTGGGGAGTGCA
GAGCGATCGTTCATTCTCGCCGGCTGCATTGGCGCAATGGTGGTCGGCGCCAGCATGCCCGGCTCGGCAATTCTCATCTCGGGGCTCGTAGGCTCGATGA
CGGAAAAGTACATGCTGTACCAGCACTTTAAGCAACGTGTGTACCTCGAGCAGCTGTACGACCAAGTGCAACTCTACGGAGCATGCTACGTCGGCGGCGC
CGGTGTCTTGCTCGTTGCGACGGCCGTGCAGCAGTACTGCTTCAAGTACATGAGCGAAAAACTCACTTCACGACTTCGCGATATGCACTTTACGGCCTTG
TGCCGCCAGAACATCGCGTTTTTCGACGAGGCCGCGCACGCGACCGGCGCACTCACGGCCGATCTCGCGACCAATGCTACGAAAGTCGCGCTCTTGTCGG
GCGACGCACTAGGCCGCGTCGTGCAGGCCATCTGCACGTTTGTCGCGGCCATCGTGATCTCGTTCACGCTCGGCAGTTGGCTGCTCACGTTCGTCATGCT
CGCCGTATTTCCGCTCTTGATCGCTGGCCAGTTTATTCGCATCAAACAAATGAAGGGTGACACGGGCTCGGACTTTTTGGGCGACTCGGGCGCGCACGCC
TCTCAGGCGCTCAGTAATATCCGCACGGTCGTGTCGCTCGGACTCGAAACGCAAATGGTCGAGACGTACGGCGCGCTGCTACTGGCGCCGCTTACAAAGG
GAACCAAAGAGGCTCACGTCAATGGGCTCGCACTGGGCTTTAGCTCGGGCATTGTCTTTGCCGTCTACTCGCTCGTGTTTTGGTATGGCGGCACGCTCGT
GTCCAAGGGCGACATTTCGTTCCAGCAGCTCATGCGGTCGCTCATGGCCATTATGATGTCAGCGCAAGGCATAGGCTCGGCGGCCTCGTGGCTCGCCGAC
ACAGGCAACGCGACGCAAGCTGGGTCTGCGATCTTTGACGTCGTCGAGACCACGCTCACGATTGATTCGTTCGCAACTGACGGACGCATGCTGGACAAAG
TCGAGGGCAAGATCGAGTTCCAGAACATCACGTTCCGGTACCCGACGCGGCTTGAAGTGCCCGTGCTTCGCCACTACGACCTCACAATAGAAGCGGGACA
GACGGTCGCATTTTGCGGACCGTCCGGTGGTGGCAAAAGCACGTGCATCTCTCTCATTGAACGCTTCTACGATCCGCTCCGTGGTCAAGTGCTGCTCGAC
GGCCACGACATTAAAAGTCTTAATCTGCAGTGGCTGCGTCGCCAAATTGGCTTGGTGGGACAAGAGCCGACGCTTTTTATTGGTACGATTGCCGAGAACA
TCGCGTACGCGTTGCCCGAGATGCCGTCCCAGGGAGAGATTGAGGTCGCTGCTAAGATGGCGAATGCCCACACGTTTATCACCAACTTTCCCGATGGTTA
CAAGACGCAAGTGGGCATGCGAGGCGAAAAGCTCTCGGGCGGCCAGAAGCAGCGTATCGCAATTGCGCGTGCGATTCTCAAGAACCCCAACATTTTGCTG
CTAGACGAGGCTACGAGTGCGCTCGACTCGGAGAGCGAGAAGATCGTGCAGGAGGCGTTGGACAAGGTTGTGGCACTGAAGCGCCGCACGACGATCATCG
TTGCCCACCGCCTGTCGACCATCCGCAAGGCTGACAAGATCTGCGTCGTCAGTGGTGGCAAGATCGCCGAGCAGGGCACCCACGCTGAGCTGTTGGCATT
GGGAGGCATCTACAAGAAGCTCGT