Description :
From Genome Similarity Track
Location :
Scaffold_94:89189- 93066
Transcript NameFunction/comments
Physo_141105hypothetical protein
Physo_141106putative guanidinoacetate N-methyltransferase

Sequence
3877 bases(100 bases per row)
ATGCAGCGATCGTGATTGGCACGTCAAAAACCACGTTGTCGGTCTGGTAGAGCATCGTCAGCAGCTTGTCCTGGGCGGTCTGGGGGTCCGACACTTCAAC
GGTGCGGATGTACTTGGACAGGGTCTTGACCAACCCCATCATCTCCTTGCCACACTTGAACGCAATCTGAATGCCCTTTGCCATGAGCTTGAACTCGCCG
TACATGTTGTAACTCGCCACAGAGAAGACGGCCTGGGCAACGGATGCCACCTTGCTCACAACCTCGAGTGCGCAGTCGTCGTTCTGTCGAATGCACTCAA
CTCCACACTGCACGGGGTACGAGTAGGGGCACTGAGCCCAACACGTTCCAAGCTTGCTGTTGAACCCCAAGGGACACGTCTTCGCGATGTGAGACTCGCG
GTAGCATGCCGTGTCGGCCGCGGTGCCGAGCGCGGAGCCAATCCAGTTCTTGTAAGTGGACTTGATCGTGCTGGTAGCATTGAGAGCGTTGCCAATGGTG
AACCCCACGCTTGTAGATACACTGTCATCATCGCTGTCTGAAGAATCGCTGATGTCGTCTTGGCTGTCCACTGACTCGTCGTCGCTGTCGTCGTCGATAG
CCGATCTGAAAGTGATCGTCGCCTCTGGAACCGTGGCAGTGGCGTTCGCTCTGAAGTTGGCGGCGGCCACAGTAGCCACCGGCGTTGCTGCCGTGCTTGT
GTTGAAAGTGCACGACTGCGCGCCGGTACATGCGCAAAAGACCAACGCATAGACGAAAGCCAATACCAGAACTATCCTGGTCATCCTCGAGCCTTGCGTG
TGGAGGCGCGTAGCTTCGGGCAAAATTAAGAATGAGATTTAACCAAACCGCCAGAACTCCTAGCTAAAATGCCTCTTTTACGAGCGTCCTTGCCGAGGCC
ATCTTGCCGCCAAGCGCAGGTGGTGACCGTCTCAACCCCGAAAGATTCGTGCCGGTCGTACAGTAACCACCGCCAGCAGCCGCAACTTCAGTCTTGTATC
GAATCTAGCTTTCCGGCGCAACGACGAATCTGGGTTTGGCAAAGCCGCGACCTGCATCAACACGGAACGGGCGCTGCTCCGGTCGTTGCAGTCGAAGTTA
GTCTTGACCAACACATTCGGAGTTCGCTCCTCTTGGCAGATGGCCAACACAATATCGCACCGCCTCGGGAATTGTGAGTGGGGTTGTCCTCGGGATTCAG
TTGGCTCGCGCTCATGCTTACCGGGAATCTGCAGCCACCGCAGCGCATGACGTGGAGGTTTGCATTGTCCAGAGTTGGGATACCAGGCCGGATTGGCACA
CCATAGACGAGGCCGCTGTCTCGGTTCGAGGTGCGTTTGTAGCGCCGTGCTGAAGCGATTTGCACTGATTGTAGATTCGACGTCGAAGTTGCAGCGGTCC
CTACAGAATTCTGCCCGAATAAGGAACGGGTGTACAACTAATAGCCTCACATATTTAATATTATTTTCCAGTCGATGTGGCGATAGGGGGATGTGCAAGG
TACTGCAAGGTACTCATTTAGCGATCTTTAGTGGCAGACTCGCACTTTTGCTTTTGCACCTCGCCCCACAAGCCCACCTCCTCCTCCACTCCACCCATGA
AGTCCACACCGTCCAAGCGTCTCCGTCTCACTTGGTCTGAGAAAGTGGGCATCCTCGACAAGGTGAAGGGCTAGATAATCCCTACGAGGTCGACCAGTTG
ACAGCGCTGTGTGTGGTGCGAGGATGCCTGGTCAAAGGTTAGTGCTTCGACCATACGCCACTGTTGGAATCATTCCGGACTCGTAGGTAAAGCTGCTCTT
CAGTTCATTTTGAAATAACTAAATCAGTACATTGGAAAAGTATACTCAACTTAACATCAATTTATATATTCTGCGTCTTTATATATATCAGGCGTTCCTT
ACTCGGGCAGATTACTGTACTTCAATCGATCGTTCTTCTTGGATTCTTGGATGAAAGAGCTGAGATTATAGCCTTCCCACGGATTCTTGTTGCTCGTACT
GGGTTTCACATCTATCGGCATTTGCATCATTGCCACAGCTAATTAGCATTCTGAATATAAGCACCCCATGGTCACCTTAGTTGTTACAAGATCTCGCGGT
ACATGAACCTGTTGCAGTTTCGTACTTCTTGAGACGGGTAAAAACATCGGCAGACCGTCTCAAAAATATCATGCACGTCGCGATTTAGCGTTTGGATCAG
AGCGAATGAATCTACGATTCATTTTACGCCATCGTAAGTGGCCAGAAGCTTCGAACTGCTGGTCTGACAGTAATTTCTAGACCGCCTCCGACCCCTTCGT
GCAATATGAGGTGATCCGCAATGGTGTACAGTACTGTATCTATCATAGCATTGCCTTTAGCGCTGCCGAAGTCCCGCTCGAGCGGACGGTAGCGCACGAC
ATCATCATACAGTGTACAACTACAAGATTCCTTGGTGGGCCACGAATCGTGGTGCTCCTTCAAGGACCCCTTGCCCAAACGAGCTCCCGCGCGAAAATAC
GTTCAGGACAGGTCACCCAGACTTTTGTTTGGACGCAGCAGCCCTGCTTCTTAGCGCGCTCAAAAACTCTCGTCGCGATTGCTCATCGGTGTAGTGGCTT
GCCCTCCTGCTGTTTTTGCCATCTTCGTATAGAGCGTGGTCCGCTGAAGCTGCTTCATCCTCCACGACACTACCGCCGCCACCGTCGTCGTCTTCGTCTC
CAAAGCTGTCCGATTGTTTGTGCGAAAGTGCATCCATTTCGTGAGCTAGAAGGAAATCTCGGATCTCAGCAATCTGCCCGCGCTCTCGTGGAAAATTTGT
CGGTTGCGGTAGTCCGGGCCTGCTCGCACTCTCGAACGCACGCTTGAACTTCTTAGACGGGCGAGGCAAGAATGCCAGTGAATCGGCCCCAGCGCCAGCC
CCACTCGCAGCAACCAAGGAATCTTCAACGGTGATCACCGGAACGAGAGCAGTCTTGTGCGGGAAATAGTTGCAATTCGCAGAAACGCCGACAAGCACCT
CGGATACTGCTACACAGCATCCTGAACGCTGGAGATCCATCTCTCGAGCCAAATACCCGGACACCCTAGCTCCATTCGCACAGTGTTTCAATGCGACATC
AAGGAAATCGTGCCAGCGCGACCTAGGTACCCACAATTAAAATACAAAACCCCTTAGCGTGACACAGTTCCCTTTCTACCTAACTACCACTCGAGCAACT
CACCGTCGCCCACCGTCTCCTCCCTCTCTTGTAGGGAACTCCCCGGATTCCAGCTCCGGAAGCGGGTAGTCGTCGAAGAAGACGCAGTCGAATTGGTTCA
GCGTCGGCAACTGCTGCTGCCACGTACCGGCCACAATCTCCACCCCAGTGTGAGCTGCTGCAAACAGCCGGGCACGTTGCAGCGTCTCCCGATCGCACTC
TATGATCGTGTGGCTCCTGGGACGGAATGTCTGGATGCGAGACGCCGAGTAGGCCAGACCGAAGCCGATCTCCAGCACGCGGTCCGACGGCTGGATGGCG
AGCGCGTCCACGCATAGCTCCATGTACTTCTTCTCCCACTGCATCATCACCTGCTGCCCCCGCGAGCTCCAGAGTACTTCCTGCCCCAGCTCGTCAAGCC
CATGGACGTTGCCTTCGGTTGTCATATTTGCAATTTATGTTTGTAGACCAAAACTCATTTTTCACAAACTATTGGTCGCGCACATTTCTTTATGATACAA
AATACTCAGTTTGAAACAAATACATAGACTATGCATTATATATATATATATTGTATTAAATATAAATATTGATTTTGTTTTCCCAAGAAATTTGTCCTAA
ACCTTTCGCAAAAACTGCCGCCTTCATATTTTTGAGTCAAGGTGATGGGAGCGACTTCATTTCGCTAGTAGAGGTCG