Description :
From Genome Similarity Track
Location :
Scaffold_94:89175- 90213
Transcript NameFunction/comments
g11220.t1ETP53100.1 hypothetical protein F442_01975 [Phytophthora parasitica P10297

Sequence
1038 bases(100 bases per row)
CGTTCTCGTGCCTCGGGTGGCGCCAAACGGGCGACTGCAGCCCCGACGGACCGCGGGAGCCCGACAACGACGCCAGCTGCAGCACCAACATCAAGGCCGG
CGCGTCCGGCTACTGTCTGCTGCGCAACGAGGACACGGGGGAGGACGTGCAGGCCATGCGCGTCAACTGCTCGTCACTGAGGGACGAAGTACGCTTCAAC
TGTCGTCAAGCGGCGGACTTTGCGCGTGTCGCACCGCAGGTGGACGCATTGATGTCCGCCACGCGACAGGAGGAGACCCCGAAGCAGGAGGAGGTGGCCA
TGGAGCCTAAGAACGGCGTGTTGATGGTCATGTACCCGGAGCTGCTCTCCAGCGTCTACTCTACCGTCAGGTTGCTGCGCTCTTCCAACTGTTCGCTGCC
AGTGGAGCTGTGGTATCTCGAGAAAGAAATGGGTGCGAACCCGCTGAATGACTCGCACTTGCTGCAGTCGCTAGTGAACGAGTATGGACCCATTTCGCTG
CGTGGAATTGCTGAAGGAGACGTTGACGGGTTCAACTCGAAGGTCTACGCGCTGGCCCACTCGGAACTCGACCAGGTGCTGTTTCTCGACGCTGACAATT
CGCCGGTGAAAGACCCGACGTACCTGTTCACAGCGCCCGAGTTTGTACAAAGCGGCGCCATCTTCTGGCCGGACTTCTGGCACCCGATGAACACCATCTT
CAACGTCAACAAGCAGAGCTTGCTGTGGGAGCTGGTCGGCACGCCGTTTGTGGACATGTTCGAGCAGGAGAGCGGCCAGCTGCTCATTGATCGACGCAGA
GCCACCGTGGCGCTGGAGATCGTGCAGTTCTTGGCGCTGCGCAAGCCTGACCACTTTGAGCGATTCAAACTCCTTCACGGGGACAAAGACCTCTTTCGCT
TGGCGTGGCTGAAGACGAACACGTCTTTCCACATGATCCAGACACCTGCCGCAGCTGCAGGTATGGTCAAGGGGAAGCAGTTCTGCGGGATGACGATGGT
GCAGCACGACCCGCAGGGTGAAGTGCTCTTCCTGCACC