Description :
From Genome Similarity Track
Location :
Scaffold_665:8915- 9999
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_665-fgenesh-gene-0.2Phosphatidate cytidylyltransferase

Sequence
1084 bases(100 bases per row)
CGCGTCGTCGTGGGCTTCGCCATGATCGGCGTCTTCGCGCTCATCATGTACGGCGGCCACCTCTACGCGTGGGTCATGGTCGTCGTGCTGCAGACGCTCA
TCTTCCGCGAGCTCGTCAATGTGCGGTACAAGGCCGCGGCCGAGAAAAACATCCCGTGGTTCCGCTCCATGCAGTGGCTCTGGTTCTACGTCGCGCTCTT
CTTCAACTACGGCGACTCGTTCGGCGCCTTCCTCGAGACGCGCAAGCTGCGCTTCGTGCCGCCCGTGCTCGTGCACTACCTGCGGTACCACACGTGGGTC
TCGTTCGCCATGTACACGGCCACCTTTGTCATGTCGGTGCTCAGCCTCAAGCGCGGGCTCTACAAGTACCAAATGGGCCAGTACACGTGGACCATCGTGA
CCATTGGCATGATCGTCTTCCAGATGAAGTACGTGCTCACCAACATCTTCAACGGGCTCTTTTGGTTCGTGCTGCCCGTCTCGCTCGTCGTCTGCAACGA
CTGCTTTGCGTTTTTCTGCGGGAAAATTGCCGGCAAAAAGTTCATCAAGACGCCGTTTCTAAGGCTCTCGCCCAACAAGACGTGGGAGGGATTCATTGGC
GCGGGGCTCTGCACCATTGCGTTTGGCTTCTTTGCAAGCGCGTACCTCGCCAAGTTCCAGTGGATGATCTGCCCGCTCGAGAGTCTCCAGCTCATCCCCG
AGACGCTCACGTGCACGCCGCCCGAGTTCTTCACGCCGCAAGTCTACACGCTCCCGGCGCTGATCGCCAAGTACGTGGGCATGAAGGAAGTGCTGCTGCT
GCCCGTGCAGGTGCGAATAAGATCCCTCTTTCTGATGGATGGAGAGATACTGACGTGTGATTGATGGGGTGTGTCTGGCTGTAGATTCACTCGATCGTGT
TCTCCATCTTTGCGTCCGTGGTCGCGCCGTTCGGCGGCTTCCACGCGTCGGCGATCAAGCGCACGTACCACATCAAGGACTTTGACTCGGTCATCCCGGG
CCACGGCGGCGTCATGGACCGCATGGACTGCCAGTTCATCACGGCGCTCTTCACGTCCGTCTACTACAGCACGTTCATCCGGTA