Description :
From Genome Similarity Track
Location :
Scaffold_8:89132- 90827
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_03126ubiquitin-specific peptidase 22 (C19 family)
Sappa_CBS223.65SPRG_03127PREDICTED: kinesin-like protein KIF3C-like

Sequence
1695 bases(100 bases per row)
ATCCAGATGCGTGCGCCGGAGGCCAGCCCGCTGGCGCCGTCCACCCTTTTGTACGCCATGTGGCAGCATGCGCCGCACTTGGCGGGCTGCCAACAGCAGG
ACGCGCACGAATTCCTCCTCGGCCTTCTCGATGGATTGCATAGCACTACGTCTGGTATGCACAGTCCATTCTGTACCGTACTACAGAGGTCGAGTGCAAT
GCGTAGATCCAAGTCGACGTTGGATTCTATCCTGCTCGTCGACGGTACATGCTGCCTTTGATGGTGTCCTGCGCTCGGACGTAGTCTGCGCCACTTGCGC
TTGCCGATCGACCGCAGTCGAGCGCATGATGGACGTGTCGATCGCACTTGGCTTGTCCTCGCTTGAAGCTTTGTTTGCGAGGTATACGCAGCCAGAGCCC
GTTGTCATCGACTGCAGCGTCTGCGGTATGCGGCGCCACTGTACAAAAACCCTATCGTTCCAGACGCTGCCCTTGGTGCTTGTCGTACACTTCAAGGTCG
TTGATGCATATAACCCATCCTCATTTCCCGTAGCGCTTTGCCGCCCAGCGCAAGGTGACGACGCCAGTGACATTTCCACTCGGTGGTTTGGACATGGGCC
CATTTCTCGCCGCGTCCTCGTCCTCGTACACTACGTCCTTGCTCGCTGGATAGTTGTTGATGTCGTGTAGGCCGGTATTATACGATCTCTTGGCGGTCGT
CAACCACCACGGAAGCTCTGTCCACGGCGGCCACTATAGCAGTTTTGTCTGCTCGAGATCGTGGTATGCCTGTGACGACGCGAACGTCACCGCCGCGACC
GAGACCGACGTGCTTGCGAGCCAAGCGTACCGATGGAACCGTACTTGCAGGATTTGAAGCGTGGTATTGGATTAGATATCTGCTCTTCTACCGTCGCCGG
CTGCCGGTGGCTTCTTCCACTGCGTCTCGCCCGTCGAGGGATTGTGAAAGTACTTGAAACCCGTGCGTGCGTCAACGTATTCTTCCCACTGATTCGTTCC
GTCCGTTTTGTGGTTGTTGTCGGGTGTCTGGGTCTGGTGCATGTCTTTGGATAATCCAATGCTACAATCGCAAGCACGTACTGTGGCCGTGCGTGGGACG
AGGCGCTCCTTGGTCTGCCGAATGTCCTGTAGCTGGCGCTGCACGGTCTGCTCGAGCAACGACAACTTGTCCAGAATAAACGCGTCGGAAGCGTCTACGC
CACATCAGACAAGTTGTCACTCCTGTGAAACCGGTGTAGTACGTGTTTGGGCGACAATGGTTGCTGCGTCGTCCGACAGGTTGCTGTTGTTGTTGTCGCT
ACCTCCGTCACCAGCACAGAAGGACTCGCGGCGGATCTACCGAGGCAACAAGTACATGCGTGACGACCCTGACATGTTGCGGACGGCTACCTGCGTGCTC
GAGTCGACGCGCTCGACCGACGCCGTGTCTTGCAAGAGCGACGTAAACCCCGCGAGGAGCTTGCTCTTTTGGGACCGCTCCTTTATAGCACACGATGAGC
GATAGAGCGAACGCGGTCATTGTAGTACGTGAATGAGCGCCGCCCGCAGTTGTTGATTCTCCATCTGCAGCGCTTGCACTTGTGCTAGCAACTATAGTTG
GATATGGATATCGTCGTCCCATGTTCCTGGGCACACGCACCGCAGACGACGCCGTCGACGATATTTCCTTGGCCTCGACTAGACACGTTGGGTCA