Description :
From Genome Similarity Track
Location :
Scaffold_444:8912- 11438
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_444-snap-gene-0.11Phosphatidylinositol kinase (PIK-L4)
Pytve_DAOMBR484maker-pve_contig_444-fgenesh-gene-0.0Mitochondrial ribosomal protein L51/S25/CI-B8 family protein
Pytve_DAOMBR484maker-pve_contig_444-fgenesh-gene-0.5Eukaryotic translation initiation factor 1b

Sequence
2526 bases(100 bases per row)
TTCATCAACAGCTTCTCATCCTTCGCAATAAATATGCCTAGCAGTTGGCACAGTCGATCACTTGCTCTGTCGTTTTCAACCGCGGCCCAATGCTCGATCA
CGAGCTGTCGGACAAGTATGGTCACCGCTTGCCGTAACACCAGCGCAGACCTGTACGAATCAACTTGCACACGGGGAAGCAAACTCTTCAGCTGTTCCAG
TCGTTGGTGGCGTTCGCGCTGATCTGTGATCGGCATGCAGCCGCACACCGTTGCACAGCTCGTTGGACGAAGCGGTCCATCCGCCTCTTGGTACACGTGA
ACGGCGGTGTCGAGAAAGCACGAGATCGCCGCAGCTTGGCGCAAGTCCATCCCGTCGTGGTTGCTCAGATACGCCTCCAGCAGGTACGCGTCCTCGAGCA
GCTGCACAGCGTCCCGGAAGAAATGCAGAAATGCGTACACGTCGTGCGTCTCGAGGAAGCGGGTCATTTGGAGCGTGACGCGCAGCACATGCGGTTGGGC
AGCTCGCAGCGCTACATTCGTGTAGAACGACAACATGTAGAACAGCATCGTGGAGAGAGACGAGTACGAGGGGGAGCCAATCGCAGCCGTCCCGCCGCCA
TCGCGCCGGCCCGCTCGTGTTTCCGTCCCTTCAATGAAGAGCGTCATCGAGTGCGGACAGACGTCCCCGCTGAGTAGCAGCCCCAGCAGCTCACACAGCT
TCTGCAGCACGGTGACCGCGTCATCTGCCGAGAGCCCCGAGATCGGGCGCATGAGCTTCGGCAGGAGCTTACGCAGCTTGCTCAGCATCGTCTTGCACCG
CTCCTTGGCCGCAGCGGCCGCCGAGTCGTACGCGTTGTCCTCGTGCTGCCGCTGGTGGGAGCGCACGAGGTGCAGCAGCCCGTCGATGTCGCTCTTCTCG
GCCTCGGCGCTCACTTGCCGCGCCTGCGTTCTGCTCGTGCCAGTCGCCATGGCGGCCACGGCCAGCTGGCGTCGAGGTGACTTGCGTGGTGCTTGCTTTC
CCTTTGCGCGTTCGCTTGCCGGGGCGGCCCAACACTCTCGGACTTCAAGCGTTGCTTGTTGTTGGCGCGAAATGCCAATCAAACCGCACCTTACGGCAAT
AATCGTACTTTACACAACGTACTTAGAAGGATAAACGCTGGAGAACGTCCGTGAGGCGGTGGTGGCGCAGGCAGCGCATTCCCCTGGACCAAGATGGCGA
CGAAAGGCGTGTGGCAGCTCAAGGAGGTGACGATCCGGTACTGCCAGCATGGCGGCAGCAGCCGCTACATCCGGTANNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCGTGTCTGACGTAATGTGCCGCGCGGTGTTGTGGGTCTCACGCGCGCTCGCTGTTGCGGATACGCAGGCAAATGTTCTCGGACCCGCAGTTCCTG
AACTTCGTCAAGGAGAACCCGCAGGTCAAGTTCCAGACCCAGATCAAGGGAGCCAAGCACCCGGTGCTGATCGGCGACTATGGTATGCAGAGGCGTTTTC
TGTAGTTGTTGGTCCTGTTCGCTGACGGCGTGCCAATGCGCTTCCGTTTCCAGTGACGGACCGCCGCAAGGTTGTCGACGTGAAGAACCAGGACATCAAG
TTCGTCATGATGCAGGTGTGTGGCCGTCGAGATGACATCACGTAGCTTTATTACCCGCACTGACACCTCGCGACCGTCGTGTCTTACTTAGCTCGAGCGA
CTGCGGAACACGAGCGGCCGCAAGATGACGGCGCTCAAGAAGCCGGTCATCTCGGACCGCCCGTCGGTGCAGGGCATCTGGCAGCCCGACCTCGAGTTCC
CCGAGTTCAAGGTGGAGCACCATTAGAAAACAACCCGGCGGCCTTTGTTGCCGAGTAGCTTTGCTTTCGAGGCATTGAACGAATGCACGGCACTGCAGAC
AAACACACAGCATATTCATTCAATACGAAAGGCAAGCACCGCGACGCCTCGCTCTAGACTCTTGCATCCTACCCGCGGTCTCAGCGTCCCGCTGCTTCCT
TCCTGCTAGCCACAGCGAGCTGCGGCTCAGATGCCCTCGACAACTTAGAAACCGTGGAGCACGATCTGTGACTCGGTGCAGATCTCCTGGTCCACGAGGA
ACTCGCGCACGTTCGTCCGCTGGTCGCCCGAGAGCTGGATGATCTCGCCCAGCTCCTCATCCTTGACCACGGCGCCGTTGCAGCTGAAATTCTTCTTGAA
CGCCTTCAGGATGCGCTTGATGTCCAGGTCGTCCGCCAGACCCTGCACCGTCGTGAGCGACTTGCGGCCGTTGCGCTGCTGCACGCGCACGTGGACCTTG
CCACCGCCGGTGCTCGTGTCGTCCTTGGCATCCGCGAAGGCGTCTGTCACACCAGTATAGTTAGCAAACTGCCACACCCTCAAGTCGCTGCAGCCGCACA
GCGCTCACCGAAGGTCTGGAAGTTCTGGATATCGGCCATGGTGGCGTTCGGGCTTGGCTTTCTCGAGCACGAAGTTTCAATGGTGCGAGGGGATACGAGC
CAGAGACCCTCTGATTGGACAACCCT