Description :
From Genome Similarity Track
Location :
Scaffold_84:89104- 91872
Transcript NameFunction/comments
Hyaar_Emoy2808614transglutaminase elicitor M81C

Sequence
2768 bases(100 bases per row)
ACAGATTTGTATGCTTGACGTCGCGATTCTGCCTCTCATGCTGTCCGACCTGAAAGCGGGGTAAATAACCATCTCTCCGTACGTTTGTGGGGCCTTTCGA
GCATATGTATGTCTCCGTAAGTCCATCCAGTAGATCAGAGTATATGGTAAAAGATATAGCAGCAGACACCAAATTGACTTGTAGTTGATTTGCAGCTGAT
ACTGAGAGGCTATCCGTCGCAAACCGCTGACGGAAGGTTCCGTGCAGTGTATCACATTATATCTCGTTCCTTCGATTAAGATACGAGATATAAACGCAGC
TACTCACGCGATTAGCGGGAAATGACTGACTATTAAATGGTTCAAGGGTCACAATATCGTTGACTCAATCCCCGTCGTTTGTCGCTCGTTGTCTGTCCCA
ACTGGTACGACAATAAAAGGTTCATGTAGTAGCTAGTTTCTACCATATATGATGGATTGAGTCGTGCGGATAGAGTATCACGTGGCATCACAGTAGCTTA
GTCAAGCTAGGTTTGGATGATAGTCCATCGCCTACGAACGGGCGATCCTAGAGAGCGTGGCACGCTTCCTTGAATTTCGGCCTTCTTTCGTCTGGTTTAG
CTCGTCGTAGTGAGCCTTAACGTTTTCCTTTAATGGTGCAATCGGTAGGTCCACACGCCACCTTCCATGTGCCACAACCAGCAGGTAGCTATCTTCCAAC
GACTTAGTCGTACACAGGGCGTCCGGCTTCAACTACCGATAATTCGCTAGTCTAGCGAGCTGGACGAAGGTCATTCCCCAATTTTCTCGCTTCCGAGAGA
ATTACTCGACTCTCGTCTTCCCACTCCTATAGCATGGTCTATGCGGTGCATCGCCACCTCCTCTTGGCAGCTGTAGCTCTTGCCGCTGTACAGTTAGAGC
AGGCTATGGCCACGTCTCTCGATTACGACCCCGTAACGTCAGCCAACACGACGAACGAGATCAGCAGCAAATTTCCAGGTCGGGGAGCTGAAGTGAGCGA
CGACGACTGCTCCATATCTGTCGAGGTGGACCCGACACTACCTGATATCTCTACCATCCTCAAAGTTCCCGTGATGTACACGGACCTACTGGCCAACATG
ACGACGGCTCCAATGGAGTGTGTATCTTCAAAGATCGGCACGGCCGTCTTGTCTGAGGCCCTTCCGGCCACCGAAGCTGATCAAGATGCGTACACTACCA
CTATCTCGGGGTTCAATGTACCGTCCAAGACGGGTATCACAACCGCAGCTTCAGCCACCCCAACACCAATCACCGACGTTGAGACTTCTGAAGACGAGCT
GAACTGTGCCACCGGTTGGACTAACTCGAGCCGCAAACTACAGGATACAAGCGAGACCAAGCGGCGCCTGGAAGCTACTACGAACGAGGACATTGCGAGA
CTTGAGGCCTATTTTGGCACGTCGATGGAAATGAAGCTGGCCAATCTGCCGACTGTGGGTGTCTTAACACCGTCACCGTGGCCTGGTCCGTACTGGCCAA
TGTTTCAAGACAGCATCAATGTCATCTGGAGCCCTGGCCAGCCAAGTGCTGCTGAGAAATACGCGAAAGCGTTTGGATTGAACGTCCGTGACTTTATGGA
CAAAGTCTCGGCCGACAACGGTGTCGACTCTATGCACCAGCGCCCCAAGTGTTCGTCGGACGACGGCTGTTCGTCTCGTTCCGATGGAAGTGTGTGCGGG
AAACGTGCGGGAAAGAGCTCTGGGTACTGCATCCCGACTTGGTTCGGGATCTGCCACGCCTGGGCACCAGCTGCTACAATTGAAGAGGAACCGCGGTGTG
CTGTGACACACAACGGCGTGACGTTCCAGCCGCTGGACATCAAAGCTTTGATCACGAACGTCTACGATGGCGCGTCGGTGCCCGTTGTCTTTACTGGTGC
GAGGTACAATGGCGGTCACGACTCCGAGGACGCGTACGGTCGTCACTCGAATGACGCCTACCGTGACCTCAATCCTGCCTTCTTCCACATTGCTGCTGCC
AATATCTTGGGAAAACTTAACCGCACGTTCGTCGCTGATGTAACGGCTGGGACGGAAGTGTGGAACCAGCCCGTGCGTGGTTTCAAAGTGTATGAGCAGA
CTAAGATATCGGTAAAAGAGGCTGCTCGGATGTTTTACGGCCTTGAGAAGTACCCGTGGAACGCTGCGGCCAAGAGCATTGTGTACATTAAGATGCGTCT
GTCCTGGATCTTCGAGACGTACGACGACGGTGGTCTAGTGTCCTCTGGTCAGGTCAACAAGTACACTTCGGGTGCGTACTACACGTATCTGCTTGAGCTG
AACAACAACGGGAAGATCATTGGTGGCGAGTGGGTCTACGAATCAGACAGCACCCACCCGGACTTCCTTTGGCTCCCGAAGTCGAAGCCAGCTCTTGACA
CTGTGACTAGCGTGGGGCTGAAATACGCTGACGTGAGCATGCTTCTGGAGAAATCGGTGGCTTGCTCCGGTTCTCGTTCGGGTTCTGGGTCTGGCGAATA
GGCCGAGTCTCTGTCGATCGGCGAATACTGGCACCATTAATGCGGCCTAGTAAGCTACCTGTATGTTTGGTTCATCGGTGTCTGACTTGGTCTTTTATTC
AGCATCTGCTTCGACCTCGAGTTCATATTCAGATGAAGTACCAACGGAATTGAGCACGGTGTCTCCATGTCAGGACTGTCGCTCTTCACCAAGAAGGCAG
CTATGTCATGAAATCAATGCGATTATAGTTGAGGAGGTTACAAGGGGGTACCGCCGTTAATGAGGACA