Description :
From Genome Similarity Track
Location :
Scaffold_20:89100- 93479
Transcript NameFunction/comments
Phyin_T30-4PITG_10629Putative uncharacterized protein

Sequence
4379 bases(100 bases per row)
AACATCGGCCACTTCGCCTGCGCCATCGCCACAGGCGCGAACATCATCATCCATTCCGATCTCGTTCTCATCTCCTCGCCGAGTCGAGCCAACACTTTAT
TGGCGCTCGGCGTATCGGCGTTCCTCGTCGCTTTTGGAATAAGGGGCGGACGGTCCCCTTGAGCAACGCCATGGTCTTCTTCATCTTCTTCATCGTCCGC
ACCTTCGTCGAGCTCGGCGGATAAATTGCGCTCGACAGGACGTGGGGCTCCCATGCGTCCCACCTGCAGCGTCAACTCTTCCACCTCGCCAAGTAGCTCG
GCGGTAGTCTTCGTTTCTCCGAGCTCAGCGGTCTCGGCCTTCTCTTCATACTCTCCTTCACTTGCGTCTCCGTTCTCGCTCTCCTGGTCTTGGCCATCCT
CGTCGAACTGGACGGTTCGTCCCACCTCCATCGTCATGGCGATGAGTCGTTGATCCGCCGGGTCCGACCCCACGAGAGGCGATCCTCCAGCCGTCGCTGG
GCTTCCGTCGCTCGGAGTTGCTGATCCCTTGACCATCTTCACTCTTCTCTTTCTCTTCTCTTCCTCTTAACTTGGTTAGCTGGCACCTATAAAAACAAGC
ACACACTCCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTAGTAGAACACACAAATATCGTCAGATGTGGATTCCTTACACAAACCACAACGAATCGCCG
AGTTAGGTCGGCGGTTTGTATGGCCTGCGCAGAGGGTGGTCTCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGCTCGTTTCCACTCGGTTCCGACT
AACCAAGTCAGATCACTTACGAGACTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCAAAGGATGGACGACGGCGCGCGAG
CGCTTTTACAGGTCACCGAGCGCAGAGGCTGCTCAGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTATGCGGGACTTTCTT
TCGCGCGTAGCGAGACTTTGTCCTACCCGGACCGACCTAATCTCTTGGCGCTACCAGTCAATACTCTACAAGCTATGCCTCTCGAGTATTGACGGCAGGC
ATAATCCAGCCCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGGACTAGGAAAATTCTGCTCTGTTATCTTCTGGGAGCCTTTTCGGCTCCTC
CTATTTAATCCTATGCTTCTCATACAAATATCTAGTGAAATGTAGTCGTTTCGGATCTCTACCGACTCTTCAGGCGGCCGTTGAGCTCAGCGGCTATCCG
GATAGCATATCCGGACAGATCGCCGAGTACTTACCGTGATCCTTGGCTCCTAAGCTCTGGGTTATCAGACCGAGCCGATTCTTGACCTAAAGTAGGTCGG
CGTATGGTCGAATCTGGAAATCCCTACACCACAGCAGCATCTCGCTGTTCGATAACGATGAATCCCAGAGCAACACCGCGCTTTGATATCGGCAACAGCG
TGCGTGGCATTGTCGCTACGGCTGCGTCTCCAATGACTGCTGACAGTCTTTGGAGGGCTTCCCACTCTGGATCCGCCAGATAAAGACAGTCTGCGCGCAT
AATGTGCGTGGTAGAAGCACTTGAGCTACGCATGAACGGGTTGCTGTCCAAGGGTTGGTTCTCCACCCCGTGTACGTATTCCATACGAGCTCGCTAGTTA
GTCGGTCGTTGGACGGACTCGAAAATGTTACCAGGTGTAATGGGCCTACTTTAAGCCCACTACTTCGGCTTACACACTAGCGCACGTGTATGAGGAAGCG
TAAGTTACGTTTCACTAAGATTAACTAAACTTTCGTCCGAAAGTATAGATTTACTTAAATAGGAAAGCAAAGCCATTTTCTGGTAGAATGAGAGCTGTTT
ATTTGCTTGTTTAGGTTTTCCTCCTAATCCAATATTCTACATGAAGGGTATTTATCAACGAATGGTTGACAATATCCTAGTATTCTAATTGGTTGACGTT
ATTGAATTTCAATCAATGAATGTGTATCCATTGGTATCTTACCCAATGTGGAAAACCTCTTTTCGTAACCAAGTGGCTATGTAGCCACTTGCGTGTAACC
CTGTTACCACCGCTATAGAAACTGTAAGCAGTTATACGACAAATGTACGGCAACGCACGATTAAATAAATGGTTCTCAAATATCGAAGCCGTTATGCAGA
CAAAGCTCCGTGATACATGGACTGATCCCCAAGTTGAAGTCTGGCACATGGACGTATAGCACATCTCATGAACATAGGTGCCAATGCATGCACAAATACA
TACATGGACTGATTTCCCTACACAAGTGTTTGGATCATGTTTTGTTTCTTGCCATTTGAGAAAATCTAGTTTTTTACTTTTATTCTTTTTTAGAATCTGA
AACAAAACGGACAAACACCATTAATCTTTTAGACCAATAACACTCTTGTATACTGTCAGTTGAGCCGCCATGACAACTGCTGGCGTTGCCCCGCTGCTTG
CCGTGACGCTTATCTTCCGCTCGAAGCCTGCATTCGAGTCTCTGAGCTTAACTCACGTCGTCGACTCCGTCACCACCTTCCTAGACTCAGCGTTGGAGCT
GCCCATTAAGAAAGCCTGCCAGTTCAATTCAACGCGCCTGTTAGATCGAATCTGGGATAGCTCCATCGAGCTGGCCGCCTCTTCCGACACCTCCTGGAGT
ATACGCAATCTCCTTCAGACCGAAACTCATTACAGAGGCTTCCAGTTCACGTTCTCTATAGTCAAAGCCATACAACTGAGAAATCTGGAGATGATCCAAT
GGCTGTGCGAACATTTTCCTGCTCTCATGGTGGTTCAAAAGTGTGTGGAGGAAGCTGCAGCTGTCGGGAGTATAGAAATCCTCCAATATTTGCTTGAAAA
GGGTGTAAACGTCAACGCCCTTGACGACGAGGACGAGGACAACGAAGGTAAAACTCACACTATTGACTGGGGCTATGAAGACGCTGCAAAAGCCGCCGCT
GCTGGCCATAGTGAAGTGGTTATGTGGCTCTATGAGAATGCTGGCAGTGACGTTAGAAACGATGAAGAAACGCTGAAAGCGGTCGTCGCAAGTGGAGATG
TGACTCTATTGAGGTGGCTACTACAGAGACTGACCATTGTTCCTTGTAAAGGGGTCCATGATGCTGCTGCCAATGGACATATCACCATGCTTGAGTTCCT
TACAGAAGAGGGTTATATTCAAGACGACACTGTTGGGTTATTACTGAAAGCAGCTGATGCAGGTCAGATGGCTGTAGTGCGTTGGATCATTGACAGAGAT
TGGAGTATGGACACCTCAAGCGACCAAGAGAGTGATGACGCTGGCTCTCCTTTTGATGATGATTTACATTCTCGAAAGCATATTACCAGTGTGGGTGGTG
AAGCCAGTCTTGCCATCCACAACGCGGCTGTGAATGGTCATCTGGATGTAGCCAAGTATCTGCACGCTCGTGTTGATTGGCCTCTAAACGCTAATGATGA
GACTATCGAGCTAGCGAGACACTGTCCGATAATTGAACAGGTTAAATACCTTGGGTTAAATATTGAAGCCAAGAGGGTCTCAGGCGCAACCATGCTCCTT
GCTACTACGAAAGGATTGCTCGATGTCGTCCAGTGGCTCTATACGACATACAGCAGCGATCCAACACTTAACCTCTTTTGGTCTTGTAACCAAGATACAA
AACAACATGAAAGTGTGCTTGACGCTGCTGCGACAAATGGACACTTTGAGGTCCTCCAATATCTCCACGAAGCTGCAAAAGACGTCACTGAAGAGAATAA
AAATAAAAGAAGACGACTGCGGAAGTATCCGGATATGACTCTAGGTCAACCGATATACATGTATCCTTCGTCACCGAGAGAAACTGAGCTACAGACTGAG
CCGTCTAAGCCTGGTTACACCACCGCAGCAATGGATGGCGCGGCTGGCAATGGACATTTAAACGTTCTACGTTGGCTTCTTGAGAATGAGAGTGAAGGCT
GCACGACACAAGCTATGAGTCTCGCTGCTCGAAATGGACATTTCGAAGTCGTGCAGTGGCTATGCGACAACATACAGAAGGATTGGATTGCCAGTGCGAT
GGATAGCGCTGCTTCTGGAGGTCATATCGAAATTTTGGAGTGGCTACATGAACGCGGCTTCCAATGTTCTGTAGATGCCATGGACGGAGCTGCTAGCGGC
GGACACTTGGAAGCGGTCAAGTGGCTCCAAGACCACAGATCCGAAGGATGCACGAAGGCTGCTATGGACGGTGCGGTCTCTTGTGGAGCACTGCGCCTTG
TAAAATGGCTTCACGAAAATCGCTCTGAAGGCTGCACACGCTCAGCATTTTACAAAGCGGCTCTTCTTGGCCACTTAGA