Description :
From Genome Similarity Track
Location :
Scaffold_942:891- 5719
Transcript NameFunction/comments
g16868.t1hypothetical protein

Sequence
4828 bases(100 bases per row)
AGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTG
CGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCTGTAGCGGGCTTA
GGGTTTTGATACAAGTCTACTGTAAAATATACTGATATAAAACATAACCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGG
CACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCTGTCCGTCATTCC
GTACGCACCTCGAGCGTAACGCAAATCCGGATTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATT
CGAGCCCTCTCATTGGCTATATAGTGGAGACTCTGCGCGATTGGCTGTTATAATGCGTAGTGTGGACTACACCACATCGGAAGTAGCCGAATAAAATCAC
TGATGCTGATTGGACAAAATAAACCGCCTTTAACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGGGAGATTCCAGGCAAATTCTGCAGGTGG
TGAAGGGCGGATCGGCTACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCATACGGTGCGTCTGACAGAGAACATACGGCT
GCCACGTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGTTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACT
ACATCAAGATTCCACGTGACATGCTCATCGACAACCCGTCGGTGATCCAGATGATGACGAGAAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGC
ATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACTACCACGAACGCGATAGTCC
ATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACTAGGACGGGAACTTATTCGA
GCAGGAGGTGCTCAACTCCCTGAACATCAGTGGTATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCC
GACCTGGGGTTGTGCAACGGAACGCGCCTGCGAATCGGCGAGCTCAAAGATCATGTCATCCACGCCACCATGGCGGGCGACAGGCAAGGCCAGCATGTGT
TGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCAATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGTCATGAC
GATCAACAAGACGCAGGGACAAATGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTT
ACGTCGAGATCGAGATGCACGGCGTTGGTCGAATATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGA
GAGCGTAGGCAGCGACTTGGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGA
GCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGCGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTG
CGAGCCGTAGCAGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCGTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGT
GAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGA
GCGCAGCGAGTACGCCTGCGGTTTAAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCAAGGTAGACAAGCGAAGGCGAAGCTTG
CGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAAACACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGT
GAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATAC
TGTGATAAAACATAACCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAAC
GCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCCGGAGCG
TAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGG
CTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACATCACATCGGAAGTAGCCGAATGAAATCGCTGCTGATTGGACAAAA
TAAACCGCCTTTCAACAACTTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACGGACCAGCTCGACGGAGGACCGGGCGGGATAGCTTCGCAG
GCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATGCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGGTA
CCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTACCC
TATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTTAC
CCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTTCAG
CTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGGAAG
TCTCATACCAATCCGGGGGACTGGGATGGGTACACACAGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACACCGTGTAATGG
GACCGGCCCGTAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGTGAC
AAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCTCAAACTCGGGGTTTGTACGGCCCTTT
AATGCCTATGATGCCTTGCTGCTAAAAACATTATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGAGCTG
ATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACTAAAAAAAAGAAAAAAAAGAATTGAGGTACCGAGTCGCGCTTC
AGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCAATAAC
AAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGTGGTGCTACACGGGT
ATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAGGTACCGGCCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATG
CACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTAC
GGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCG
ATGCTAACGCGTCGCCACAAGGATATGAGTCTCCAGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGGA
GCAGATGGAACAATTGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGGACGTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTT
GGACAAGGGGCGACTAGCCAGGTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGC
GATCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAGCTCCGTGCCGAGCA
GCTTCAGGACGTACGAGAACGAAACCGG