Description :
From Genome Similarity Track
Location :
Scaffold_436:891- 5179
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_436-snap-gene-0.6Calmodulin-binding WW domain protein

Sequence
4288 bases(100 bases per row)
TCGTCGTCGTGCAGCTCGAGCCATTGAAGAAGCTGAACGAACAACCAGCACATACGGGTCGTATGGGGTGGCTTGGTGCACGATGCAGCGAAGCTGACTG
CGGAGCGACAACTCGAAGAGAGGTGCTCGTTGCACAAAATGCTGTCATGCCAAAATCGCACGCTCTCGATTGCTCGCATTGACTCGAACAACGCTGCCAT
CTGCGGGGTCGCGTCAATTTCTTCTCCTTTACCTGCCCGAACATGCACGATCGCGTTGCGCCGTTGTGCAAGTTTGGGTTTGTTTCTCGGCAGGAAAGGA
TGTAGCAGCGCCTCAAGTCTGGTCTTTGCTAATGCCACACGCGCATCGAGCCTCTCGCGCTCCCACGACTGCATACGCTCGATATTCTGCAGCGCCTTCG
GTACAGCGAACGTTCGTTTATTGAGGACGACGTTCCAGTACTCTTCGCGCAACTCCTGCTTGTTGAACTCGACAACCCACGCGTACGGCTTAATGTCGGC
GAACTCGATTGTCTGCATATACAATAGCCTCGCAGTGTTCGCAGTGCGGTCGATGACGCGTGACAGTTTCGCCTGGAAGTCGTCAGACAAATTGAGGAGA
AGCTTGTGTGGTGGCTCATAAGGTACACGTAACCTCTCATCTCCATCGTACGGCTCAAACCACTCCCAGTCGAGCACGACCGACCGGTTCGCCAGTGGAA
TGAACACCAGCACACGACCTGAAAGCAGGAGGTTCTTGGCTGATACGATTGTTGCCATCTGATTCTTCCACTCGCCTTTGCGGACTCGCACCTGTGCATC
ATATTCGCACCACGTGCGCGCTGCCTGTTCAGCTCGCTCCTTATCCCACTTTGTCCAGCGCTTAGGTGCATTGGAATCATCGCCATCATTGCCAGATTGG
TTAGTCGCCAAGAACTGTTGAAGCAAGAGCACGCGTTTGATTGCAGCGAGACGGCGCTGGCGTGATGCAACTTCTCTAGCCGTGTCAGACTTCAGCGGCG
GCGCGACTCCAAACACAGAACGCATCTTGTACAACACGGTTCCACGGATCTTATCATCTTTCTTCCGTTGTGCACGTGCGACGTGCGTCTGCCGCACCAG
CTTCATGTACGCTTTTCCCGATTTCCGGACAAGAAACGACCGGACCGCAGCCTCGATCACGGTTGCACTCTTGTTCCTCTTGACCATTTCGGCTTCGCGT
TGCCGCCTTTCCTCTTCCAGTTGTTTTCGGCGTCTTTCTCGCTCCTTTTCTGCATCCACATCACGCTTTTGCTCGGCTTGCTGGCGCAATACCGAATAGT
AACTCAAGCGATGGAACTCGTGATACTGCCGCTGGCCCTTGGCATGAAAATCAATCAAGCAGCGCTTGCAGTACACGTCCCCACATACGTCACATTTCCA
TTGCGCGACTCGATTCGAGCACTCGACACACATGACCACCAGCGCTTGATATCGATGGGTCTGTGTGGCTGAGGAGGAGGAGAGATTTCGTTCATTACCT
GTTTGCTCCAAACTTGATCTCGTTGGCATTTCTGCACTTTGCGCCGATGACTTGGCAAGTGTAGTGTCCATCTGCTTGTGCGCGACCGGGAAACAACAGT
CGCAATATGGCACTTTGCCATCCCCACACTGCAAGCATACTCGCGTCGCCGTTTCGACTTTGCAGTGCACGCAAATCTGGATCTCCTGAACGGGATGCTG
TTGAAATGCGCTACGTTTACTGTGGTCTCGAGCGAAGCACACGCGACACATGACATCCTCGCATTCAACGCAATACACTTGTGCAGGCGCTCGCACAGAA
CTCGTGCTGTCTTCATGCCGTTCGCAAAACGCTCGAAACTCCTCGCCAGGAAACGGGAGCGGGATGTTTTTCCCGCACGCGACACCCTTCAAAAATCCTG
GCCGCTTCGTGACGCTCTTGCCCGTGCCACTGTGAGTAAACTTTACCGCCTTGCCTTGATAGTCGATAAACTCGATAAACATGGCGCCAAGCATGCGCTT
CAGTTGTACCCGAAACTTGTATCGACGGTAACCATTCTGGATCCTGGTGGCATTTTGATTTTTGTGTTTAATCGCCTGTCGTTGCTTGAACACGACCAAA
AAGTGGCTGTGCTGCTTTCTTCTTTCGAGTAGGACAGCGAAGCGACGAAGCACAGCAACCGCCCACAGTACCCGTCGCATGCAAGCCTTGTCCAGCATCT
TGCGGTATTTGCCGTCTTGAACCGTAGAGGACAGGACGAAACGATTCATGAAGCGGAGGAAGTTGGAGTGGTCGTTTTCAGAGGAAGTCGCCTGGTCTGT
AGTCCCTCTGGGATCCGTGGATTGCGACCCAGTGCCAGGTGGCTGAAATTTCTCACGCAGGATCATCAGGATGGCTCTGTTGAATCTCGGAAAAGAAAGC
GTCTTCGCCTTCGGTTCTTTCATCTTCGCAAAGCACAAATCTGCCTTCTGCACTGGGAATTGGGTCTTGTGAATGAAATTGTGTGGGAGTGTCTTCAGAA
AGCGAGCGAAGTGCGAGTTGTCGATTTCAGCATTGTTGCCTGACGCGTTCCTGTACACCTCTTGCCACACTCCATCGTAGCCGAGACGCTTCCAAGACCG
CTTCAAGATGTCAACTTTGAACAACGGTCTGTCAACGCGAGTGACGTTCTCCGCTTTCTTCTTGCCTTCTCCCTCATCGAAGACTTGTTCGCCCTCTTTT
CGAACTCCTCTCGTTTCTGAGATCTTCACCGAGTTATGCACGAAGCTTTGCAGCAACAATTCGTCCTTCACTCGCGCTTTCGTCGACTCCATGAGCCGCT
TGCCCATCTCTAATTCTTCAGACAGATACTGACGGCGCCGAACCATCGAGTACAGCCATCGCTTGCCGAGGTACTTGCGGGCAACACCCTGTATCTTCCT
TGCTGACCGAGATCGCAGCCGAAGCGTTTCCTGATGTCGCCTGTTTCGCCACCGCTGTTGCATTTTAGCGATTGCGTTCACGGCCTTGCGCGTTTGCTGT
AGATCCATCCGCGCTTTGACACCCCTCCAGGCGCTCTGAATGCGTCGAGCAGAGACATTCTCCAAGCGAAGCCACGCCACCGAGCGTCCTTGAATACCCC
GAACCCGCTTTTGGATGCACACGGCTGCCTCATTTTCTTGTCTTCGTCGCGCGCGTCGTCCAAGTTCCGCTTCTCGCGCTTTTTGATATCGTAGACGCCG
GCGAGTTATTTGGCCCCGACAAAACGCCTGGAGTTTGGCAATAGCCTTTACTTCGCGATCCGTGTAGACTTTGTCGGCTCGGTTTTGGTTTGGGGCTGCA
CCAACCTTACCCCATTTTGGCTTGAAACCAATGAGAGTATTCAGCGTCGTCTTCTTCTTGTCGCGGACTTGCTCACGTATTCGCTGCCGTTTCAATTGCC
TGTCGTCGATCTTGTGCTGTCGAGCACGAACCGCAGCTACACATCGCCACCAACATTGCAACACAAGCACCGCCGATGCCACAGCTTTTCGATGCGATAG
GACTTGTCTTCGTGCCCGCTTGCCGCGATAGTACGCTTGAACCTTGGTGATAGCTCGTTTGTCCTTTTCAAACGCTGCGCGCCGTCGTTTCAGTACTAAT
ATTCGGCGCAAGTTCCATTCTCGATAAGCGTTCTGGATGGTAATCGCTGCTCCAAGTGAATTCAGTGCGGCAACCCGTTTCTCCTGCACGTTGCTCGTTC
GTTGTCGTTGATGTTCAACGCGGAGGATCTTAGTCAGTAGCAGTCGCTTGCGTCGCGCAAACACCCCGCGTGCTAGCGACTGAATGCACGTAGCCGCTTG
GACTCGTTCAACTTGTCGGAGCCTACGCCGAGTTGCCAACCATGACTCGCACGATGTTTTCCAAAACCGCTGGATTGCGCTCGCAGCAGCTTCTTCTCGT
TCACTTCGTTGCAGCCACAGAATGGCAGCACACTGACGGAAAAACCTGGTTATCCGCAACGCCGCCTGCTGTTGTTTGACTCCCAATAGCCGGACCAGCT
CGAGCTGCCGCCTCTGTAGTTCGCGTCGAAGTTTACGCCTCGCCATTAGCTCCCGAACAGCGCAAATGCCGCGCCACCAACACTGAAGACACACGCTGCT
GGTTTCTCGCTCCTCCTCGATGACTTGCCACAGCCAACATCTCCATTTCTCCATAGCGTGAGAGAGCAAACTATATTGCAGTCGTTGCCCTGCGCGGAAG
AGCACCTCCGATGCTCGCTGCTGCTCTGGTGATGCGAACTTGCCCTGTCCGAACGCGTAGATCACATCGAGTGGCAACCAGTGCCTGA