Description :
From Genome Similarity Track
Location :
Scaffold_1561:891- 4217
Sequence
3326 bases(100 bases per row)
AGCTGTCTTCAGGCAACAGCTCCTCGTCGAAATCGAGTCTTGCTTCGTTAGTCGCGTCTAGTACCAACCGATTATTCGGTCGACTGTTGAATTCGTTGAC
AGCCTTGAGTCTCGACACATGCACCACTGGGTAGAAGCGATACCCACTTCGGTCTGGCAGCTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATC
CGAAAAGGTCCATGCCATCGATGAGCTAATTTCTTCGCTCAGCCCGGTTTGACGCGTTCCATGTACAACCACGCCCGCCTCCCAATCTCAAAAAAATATC
TCGGTGGGACTCTTGCAGGATCATCTATCTCTTCCGAAGCTTCTGGAGGGTCTACCGAGTGTTCGTTTCCACTTAGTTGAGGTACAGCGGCTTTTTCCAG
TCGACTCAGGGCCTCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGACCATAGTGAGGGCGATCTCGTGTTGTCGATTGATC
TCACGCCGCCACGCTAGTGCGTCAGACGGCTTGCCGAGTCCTCGTCTCAGTGATGACGACATCGCTCGCAACGTCGACTGCGCTTACCAACCATGAACGA
GGTAGAGCGGTGTTTCCTTCCTTGTAGTGTCTTGAGAAGTATTAATAGCAAATACCAGCTTCTCCGCGATTTCGTCCCAATCTTGTTGTAGAGGGTCTTC
CGCGTACACCCGTACGGAACCCATCACCGACTTCACCGAGCGTTTTTGCTGTCCATTAGCCTGTGGCCGACAGCTCAAAGTAGCTTTTGATCTTGACTGC
ATCATCTCTGCGAACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCATGCCATATTAATGATGGGGCTCCGAACCGTCGGTACACACATTATT
CGAGCACTTGGGCAACACTCAGTGCAGTCGTATCCGACATAGCTTTGGCAATAGCGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCATGTTGCC
CCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGTCAGGTGAGTATCCACGAAGCTGCGGA
CGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGTTGGAACG
TTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAATTCTGCAAGACCTCTTGAATCATCGTTGTTGGTACCACAAGCCGCAGCTTGGTCTC
CTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCATCTTCAGACAATACGAACCGGTCAGCATACTTCCAGGCATCTCGA
GCTTCTTTGTAACTCAGCTCTTCTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTC
GTTCCCGCTGTATCGCTACCGGATCAACATCTTCCGCATCGCTAAAATGCCGATGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGATTGAAT
CTTCGGTGGACGTCTCTCGTCGTTCTTCATGCTCCTCTTGAGCTTTTGAGACATCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGT
CTGTCGCCGAGTCATCACTGCTATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTG
CCTGACAGTACATGTACTTGACGTTCTGCTCCACGTGACGAAACATCTACCGAGTCTTCATCCGGTTCGTAGATCATTTCCTGGATGCGATTCAGCGATG
CCAATTCCGACTTGCGAGTTTCAGCCAAGATGACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTTTATTCTCGTAC
AACGTGAAGATATATCAACTGATCGAAGCTTGGCCGTGAGTTTCTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAG
TGATTGTTGAATCGCGAGCCTTGAGTCACCTACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTAATCATCCCTGTGTACTGT
GCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATAACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCAC
CGTACTTATCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAGCTTGGCGTACAGCAACGCGGGGTCCATTCAAATAGT
CGGGGAACCCTTGTGTGGAGGTGCCACCGGCGCGAGTGAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCC
TTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTTGACTTATGCACCCACTCTA
ACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCTTTTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGA
ATGGTAGTTCATCTCAGCCTCTTGGAGCACACGACACGGGCACCGTACGGGGTGTAACTTGCCTTCATGTTCCTGCATTAGCGTAGTGCTCAACGCCCAT
TCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCGAAGGAACGAC
GTGCCACAGAAAGGCCACGTTCAACGGCAAAGTCCTCTTCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAATCTTGAATGAAGCGGCTGTAGTA
ATTAACCGCTCCAAGAAACGACTGCATGCCTTTCTTACTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCCCTGATACCTTCT
GGCGAAATTTTATGCGACAAAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATC
GGTCCAGCGTCGCTACGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAACACAGGTACCAGCGATGATTCGTC
TGGTTCCCCGTTCGTAAACATATCAG