Description :
From Genome Similarity Track
Location :
scaffold_1739:891- 2378
Transcript NameFunction/comments
g11617.t1 hypothetical protein PHYSODRAFT_347717

Sequence
1487 bases(100 bases per row)
GCTCACGCCACCAACAACCATGAGTACCTCCAAGAAATTCTTCACCGCGGAGGATCTCAAGATCGCTCTTAACATCTTCTGCTGCGTCTACGGTATTGGT
ACGCTCGGTATGCCAGGAAACTTCTCTCGAGCTGGCCCCGTGCTCGGTGTCATTGGCTTAGCATTCATGGCATTCACCAATGTCTACTCCTCCGTCGCTA
TCTGCCGCGTGATGCTTCTCGCACCAAAGAGCGTTAAAACCTACAGCGACCTTGGCCGGTGGTGCATGGGTGAATGGGGGCACTGGTTTGCAGTAGTTTC
TCAAATGGCTTCTTGTCTGCTGGGACCTTGTGTGCTACTGGTACTTGGAGGTTCCCTACTGGATGGACTCTTCCCCGACGCCTTCAGTACCTCCTATTGG
ATCTGCTTCATGGCGCTCATGTGCTTGCCCGTGTGCCTCATCCCGACGCTCAAGGAAGGCGCTGGAGCGGCCTTTGCCGGTTGTGCGGGCACACTCATTG
CTGACGTCATTGGCGTGGCTGTCGTTATGTACGGCATGCGTGGTCACCCAACTCCACCGTCACCGGATGTCAAGTTCTCGCAGGTCGTTGGGATGTTTGG
AAATCTGGCAGTTGCCTACAACGCTGGTATTGTGATCCCAGCCCTGCAGCGTCAACACAGCGAGCCGACGCGTATGCCCCGCGTGGTTTTCGTCACGATG
GCTTTCATATCGTGCCTGTTCCTGATTTTGGCCAGTACGGCGTACTCAGCGGTGGGCTGCCAGATCACGGGTAACATTCTATTCTCCATCTACCCAGACT
CGACGAGTGGCCTGACCACGCTGGGGTTCAAGTCGAACTGGGGTGCCGTTGTCATGGCCTACTTCTTCATGCAGCTGCACATCACGATGGCCTTCTCGGT
CATCTTGAACCCACCGTTCTACCTGGCCGAGCGCTTGATTCTGAAGATGCACCAGAAAAAGGAGGAAGACGTGGAGAACGCGCTCACCTACGCCGCTGCA
GCCACCCCCAGTAAGGACGGTGACGACCGCCGGTCGTCGAAATTATCGTACATTTCGAATGCCGATGCCGAGAACCCTTATCTTGACGATATTGAAGCAG
AGGCTGCCGAGTACCGTGGCGCCAATGCGATCAAGTACATGGTTCTCCGAGTCACCATTTTGGTGATCCTGGTGATTATCTCCATCATTTTCCGTGACCA
TTTCTCCGACTTCTTGGACTTCGTGGGTGCGTCGTGCATCACGCTGATCAGTATTCTGCTCCCGATCGTTTTCCTACTGAAGAAGCTCTGGAACGAGATC
CCTCTCTGGGAGAAGATCCCTGCGCTGCTTGTTGTAGTCATTTGTACCTTCCTGGGGTGCTATGTGACGTACACTTCGGGCAAGGCGCTCTTCGCGCCTA
CTACTTCCGACACGTCGTTCCCGTACTGCGACAGCGAATACGAGAACGAGGTTTACTACAATTACACTGCTGTGCACGGTGCGTGAG