Description :
From Genome Similarity Track
Location :
Scaffold_1229:891- 2134
Transcript NameFunction/comments
Phymu_g12967hypothetical protein

Sequence
1243 bases(100 bases per row)
atttaaggcgtggaGTTCTTCACCTAATTCGACAGTCGGTGTGGGCACCACGATAACTTGCCGGGGTTGTTTCCTGGGGGCGACTGCGACTAGGGCTTCG
TCCATCTCTTCTCGCGGGTGATGCTCGCAGCCAGCGTTCCCAAGacttcgccttcaccttTCGCGCATCGTatgatctccagcatccactGGGACAGGAG
TGCAGCCCATGAATCTAAACGGCCTTGAAGACCTAGCGATCGGAGCAACCAAGCCAATGTTGAGTATAGCGATAACACCTTGACCGGCTTGGCGACGAGC
ATGGTACGGCAGACGTCCAAGACTCGCAGCAAGTTCACGACCTTGCTCTCGACGACCCCATAATTGAGTTCGTCGGACTTCAGGATGCGACTGGTGAAGG
TCACTGGCCAGAACACGCCATCATATTCTCGCATGAGCGCCACGGAGATCGCCCACTAGTTCGCGTAGACCACGATAACCAGGGGGCGGTTTGGGTCGAA
GTACTTCAGGATCGAGGTTGACACGtttttcgccttcaacatggtgaaggagacggtggCTCTAGTCCAGCGgtcttcctcgttctccaccttgTCGACG
TCTCGGGTCTGCGACGGGCGCCCTGTGATCTCGCCTCGGTGGTGAAGTTTTAAGAAGTCGATCTCACGTCGCTCGTACAAGTTCGCGGAGTACACGGCGA
AGTCCTCGATGAAGCGGCAGTAGTAATTCAAGTTGCCGAGGAACGACTGCATCGCGCGCAATGTCTACGGGAACGACAAGTTGCACAGCGACTCCAGAAC
CTTGGGTCGCGCCTCTAGCCCTTCGATCGAGACTCGGTGACACAGGTAATCCAACTTGCGCATACCCCAAGAACCCTTGACTACGCTGATAGACAAGTTC
CAACGACCGCAAGTGATGAGCAACTTCTCAACCTTTCCGCAGAGACTATCCCATGAGCCAGTGGTGACCAGGACGTCGTCAATGTACGACCGCCGTCCCA
ATACCGAAGACTTGTGGTCCGTCTCTGGCTCGCCCGCCTCAAATACGTCAGCATAATCCTCAGAATCTTCGCCATTCCCAATCTGGAGGAATCCATATAG
GGCATTGTCCAGCAACCGCTGGTAGATCTGCGGTCTGTTCTTCAAGCCGAACGGCATGCGGGTCCACTCGAACAGTCCGAAGGGCGTAATGAATGCCGAG
ATCTTCCGACCGCGCTCCGTCATCTGAACTACCCGGAATCCGC