Description :
From Genome Similarity Track
Location :
Scaffold_3204:891- 2110
Sequence
1219 bases(100 bases per row)
GATAGAAATATGCttctttctaccaatgagatatctaaatgtatgcggaccagtcgtccacCTAAATGTAGTCATTGGTGTGCCTTACACCAAAAAAGGa
ggtaattaacttctaacagagGCCACTTTTGTTATTTACAAGTGAggtagccacttgtacgtgtaatCCCGTTACACCATCCCCCTGTTAAGCCAAAGAC
GTATTGGTCTCGACACGTCAATAACTGTATTGACCTTCTCGTCAATACTTCGGAAAAATTTGAACTCATTTCTCAATGAGCTCGTCAGCCAACACGCCAA
CGCCTGCGACGCCTAGCACCACGACAGAGGATAACGCGGAGTCGTGCTCTGCTTAAGCAGAAGCGTGGTGATGCCGCTTGGACAGATAAGTCTAAGGCTG
TCCCTGCTGAttcttcagcagcctccgATGACGGGAGCTGTGGTATTTCTGTGAACTATGAAATTAGttcagaggaagaggctcAGGAGATagaagacaa
gaagatcTCGTTTTCTAGGCGAAATGActcttcgtcctcagctATTGTTGTGCGCGACCGGGTCGCACCGCCCGCGCGAAGATGATTCGAGCGCTTTAAG
TCCAATGTGCTCGCGAAGTGAGGGAACTTCAGCGCTCGCCGCAGCGGGAGCGCTGGCGTCACCGGGTGCTGAACCTCCGCGCACTGACAATACAGCGCGC
GACCCGTTGAGCCAACTGCATCCGAGATGATCGATCGGGTGGGCGCTAACGTGCCGCCAATTATGTCGGTCTCTTCCGTGAGCTCAGGCACTATGCGAGT
AAGAGAACTTCTCGCAAGAGTAAAGTGCCCGAGTGGCAGACACTTTGAATGCCTTTGCTGAACATCTCAACAAAGTCCCTGCTGGATACCGTGCTCGGAT
TAtcgcagcacgtgaacgtttcgagaagttctcgaagcgtGGCAAGCTAGATCGCTTGCACGGCGAGGCACTTGAGGCGGGGATTCCCTGCGCCGTGCCC
GCCGGAATGCCGTGTGTGCACTGCCACCCCGGGGCAGCGCGCTTGAGTGAGAGTGATCTCAATGGGTACACGACTGTGCGTGTACCGGATAGTCTTCATG
AACTCCATGCTAGTCTACAAGCACGTGAGACTCTGAACGTTGTTGGCAAGTACAACGCTCGTGGAAGCTTTACACCTGCAGTCCGTGGTGGGCTTCGTAC
GCCTTCACCATTTCCGGAA