Description :
From Genome Similarity Track
Location :
Scaffold_7:89089- 91755
Sequence
2666 bases(100 bases per row)
GGCAGACGCGGATACGAGGAAAGACGTCCTTAATGATGGGTAGGCGAAAGGTCCCTCTTTTTGTTCCAGGAATGAAGGGTTGCCTCTAATCAATTATTAT
GGGTGGACGGAGACATCCGTTTCCAGCAGGTGAGCCTCCAAGGGTTATGCTCTTGGAAGGCTGGTTTCCCCCCAAGGGGGCTTAGTAATCCCCAGCCACA
TTCAACAGATGCGTCACAAATCTGTTGAGACCGGTGCGAGATTTCGCATCGAGTTACTTTACGGATGTATTCGTGCTATGGGAGGAAAGACGGACGTAGC
AGTTCATAGAACACATGTTCATCAGGGCTTTACACTTATGCGAAATCATAAGTTGTACGCCAGCCTCAAGAAGTGTATATAAGCTGCAAACGAATTACCA
CTTCTTGGGGGCATTACGGGTAAACTCGGTGTACGCCCTGATCCCGAAATGATCAAGGCGATCATCTATTGGCCTGTGCCAGTAGGTGTCAAGGGACTAA
GAAAGTTCCTTGGTCTAGCGGCATCCTTACACAAGTACCCGCGCAACTACGCCGAGATGACCGTTCATATCTCTCATCTCTTGAAAAAAACGAGGAATGG
TCATGGAGCGCTGATTGACAGCATTCCTTTAAAGGTATTAAGCAGAGCTTAATGCAATCGCCCATCTTAACGATTGCAGATCAGGACAGGCCATTCCATG
TGGTCTGTGACGCCAGCGATTTTGCAATCGGCTGTGCGCTAATGTAGTACGATGTAGACGGCGCAGATCGCGTCGTCTGCTATTAGTCGCGTCAGCTGCA
AGCAGCTGAGTGCAATTATCCATCGAATAATAATACTCTTTGCCATAATATACGCGCTGGCTAAATTTCGCGTCTATCTCCTCGGAGATAGACTGTTCGT
AGTCTATACGGACCATGCGTCATTACGCACGGCCGTAAACAGTCTACACATCTCCCAAAGGATGGCGAGGTGGCTTTCATTCTCCGCGGAGTACAACTTC
TCCATAAAATATAAGCCAGGACGACCTAATGTCGTTGCTGATGCGTTGTCACTCGTTCGAGTCGGCTGCGCAACCCAACAGTGGGGTCATTCCCACTGTT
GCAACACTAGTCGATATTGTTCCGTCGTCAACACTGGCTGACGACATAAAGAAGGCCCACGCAAAAGATAAGGCTCTTCTGCGACTAATGAATCCTCTAG
TAAATCCATCCCGTAAATCTCTCAAACATTTGTCGGCTTTGTATTGATCATCCGCGGATAGATACACAACACGCAACGGGTTGCTGTAAAACACAGTCGT
TCCCGGCTACAAATCTCGTGTCGTCGTTTCCACTCATAATGATTTGGTCTTACGTATCATGTATGCGTGCCACGATACACGAACTAGTGGGAATCGTGGG
CGTGATAAAACTTACCCCACAGTAAGCCGCGACGTTAACTGTCCTCGACTGTATCAGTTTGTGCGCAAGCACCTTCGTGCTTGCGAGGTGTACAACGGAT
GAAGCCTAGTCCTTCATCCCGTGCACCAGTACAGCACCTACCAATCACGGCAGAGTGCTGGTAGTCTGTTTCAATGGGGTTTGTCTTCGGATTTCCCGAA
GACGCACACAAATATAATGGTATTCTTGTGTTCGTTGATCGATTCAGCAAGATGGTATATCTTGCTGCCATTCGGGAGTCAATTACAGCTTAGGGCTGTG
CCCGTGGCTTTATTGACATGGTTTTTCGACTCCACGGTCTACCTCGTGAACAAGTCTCTGAACTAGATCCTTGGTTCACGGAGACCTTTTCTTAATCCGT
GTTGCGATCTTTCGGGACACGCCTGGCTATGTCAACATCTGACCATCCCGAGACAGATGGTCAGACAGAACGCGTCAACCGAGTCCTCGAAAGAGATACT
TCGAGGGTACGTGCAATCTTTCACTGATTGCAGCGACTTCTTGCCAATGGTTGAGTCTACCCTCAACAACTTGGTGAATGAGTCCATAACGTATACACAG
TTCTCTGTGTATGAATTGCGCCATCCGCGCCTACCCGCCCACTTAGAGTGTGACTCTGCTTCAAGGGGAGGGAGAATTCGCTCGAGCAAAAACAGTTCTG
GCTCTTGCTCATTACGCGTCGAAGTACTCGGCAACGCGAACGTTGCTGTTGTCGATCTAATCGACATCGAACAACATAACATCAGCAATTGTGATGACCC
AGATGAGGATGACGATGCTGGTATATTCAGTATCGCCAAATACTACACCAGCAAGGATGAAAAAACCCTCGATGAAGAAGAGGATGAACTCCTAGCGGTG
CGCACAAGGAGCACTGCAAAATATAAAAGCGAGTCAGCAGAAGAAGTTTTGCTGGCACAAGAGGCAGTGGTCCGTTTCGTACAAGACTCCATCGCTAACG
CGATGGACCGGCAGAAACCGAACGCTGACAAACATAGAAGAGCAAACGTTCTTCTATTTAATGTTGGAGATTTAGTCCTAATTTCTACGGTGAATCCACC
TAAGCACGTAGTAACTAATGTGGGTAGTAGTAAACTACTACCCAACTACATCGTCCTGTTTAGTGTACTACATCGCAAAGGCAATGTGTACACGATTGAG
TTACCTCCGCAGTTACGTACGCATCCTACGTTTTATGTCGGTCGCTTCCGCCCGTACCATCAGCAC