Description :
From Genome Similarity Track
Location :
Scaffold_424:8907- 10556
Transcript NameFunction/comments
Phymu_g9766conserved hypothetical protein
Phymu_g9767proline synthetase co-transcribed bacterial protein

Sequence
1649 bases(100 bases per row)
CAGAGCGAAGAAAGCGACCAAGACTTTACGTGCTCCAAAGACAGCTACAGCACGTTACGAGGTTGTCGAAGAGAAGAGTGGCAAGCAAGCAGTCTGTTCA
AGACTCCCTTCCGTTATGAAGGATAGCACGCCACTATCACCCGAGATACTAGAGCAAGCGGGAGATAGGTTGGTCGTCTCCGTTCAGTTGGCTAATAAGG
TGGAGAGAACTGACATCGCGTTGGAGTTGCGAGCCGAGTTGTTGAGTGTAAAAGCTGCAACGCATCATGATTTGGGTAAGTTCGATGCTTTTGTAGTGTA
TGTGGAAACGTATTTCTTACATCATCTGGCTGTTCTACATAGAGATCTTTCTTCCATATCCTGTAGAGGTTAACACCGCAAGAGTCCGCCTGAACCAAGG
CAGCAACACACTTGAGATATCAGTTACAATTGATAAATTCTGGGATAATGCCGGACCAGACTGCGGATCGGCACCGTGGCTTCTCGCccaggcgctggac
gacgaaaTTGAGTCAAGCAACAAAGAGGGATCGACGCccatcaaggagaagccTAAGTCATTAGTGGAGATGTTCCATCTTGCCGATGCAGCAGAGTCAA
GTGGCGAACTGTATGGAAGTGGAACTGCACAGAAGACCACACGGTGGGATCCTGtactggacgatgaagagctgcccGAGGATCGATTCCACCGCAAAGA
TATGATGTCTATGCACATTTTGGAGCAGCGACGAATTGAACGAGAGCAAAAGGCaaaagaagctgaagagaaACGCAAGGTGAGACGTACTGAGGTCGAG
GgcatgcagaagaaggcgaaagaGGCCGGCAAGACGTGGCGTGAAATGTATCCGAATGAGCCAGAAACGACCTACATCGACATGGAAGACATTGTTCGGC
AGGAAAAAGAAAGACTCGACCGTCACCAGGAGAAGCaaggcgaagacgaagacccAGCAAAAGAATGCATGCCCACAGAGGATGCACTGCGCGCTGCAGC
GAAATGGGCCGAGAACAAGAACGGCAACCTCGATTTGCAATCCGCATTGGCATTTGATCTTCTCTAGCACAACTTTAAGCCTGCGAACACGGATTTCAAC
TCTATTCCTTCTTGGCATAGTTGCGGACCCCGAAGATGGTCGAACCGACACGGACATGTGTACTTCCGCACGAAATCTACAACACAGAAAATAATTAGAG
CACTTACCACCCGTGTATCCATACGAAACATTGCTCACCGCCAATTCAAAATCCCCTGACATGCCCATGCTGAGGGCGAGGTCCGGCTCCGTCTTGCCGA
TTGCTTCAGCTACAAGCTTACGGCAGGCCACCAGACGGTCGAAGCACTCGGACGTGGTGTCACCATAGCGACCAATCGTCATGAGCCCCGTGAGGTTCAG
GTGCTCGCACGACGTCACAATGTGGCGGGCAAGCTCAACCGAACCATTAGTGTCAATACCCgacttctgctcctcctcacTGGTGTTCACTTGCACCATC
ACGTTGAGTTTCTCGGTGCGGAACTCGCCCGACGCCTTGTTCAGGGCGTTGGCGATCTTGATGGAGTCCACAGTCTCCACCACGAAGAGGTTGGGGACGT
CACGTACAAGTGGTTTGGCCTTATTAGACTGGACGTGGCCAATGTAATG