Description :
From Genome Similarity Track
Location :
Scaffold_8:89068- 90535
Sequence
1467 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCAGGCCAACGGCAAGAAGTGCCGTGACGAGGACAAGTGCGAAAAG
TACAACGACTACTTCTCGCAGTGCATCCCCAAGTAGACTCTAGTCGGACCCGTTTTGGTAGAAAACTCTTAAAATTGTTTTTACATGTTTTAGTGAGCTC
ACGAGCTTGGTCTCTAGCTGTATAACCTCAAAAAGCAACAAATAACGCGCAAAGGCGGTCTTGTCGACAGTGTTATCGTCGCGAGGCCGTTGCAAAGCCC
AAGTCTGCCTTGATCTCGACACGCCACTTGAAGAGCTTGCAAATGGAATGTCGTTGTTGCTTGCAGCAGTATGGTAGCCAAGGCCCGACTGGCTACAGTG
CTTATATCGTCGAGTCAAGCTTGAGGGCAGCAAGACCAGGCGAGGTGGACATCCTGGCACTAGCACATGGCGATACTCGTCGTTCTCCTGACGTGGCAGC
CTACCATGCCACGACGCTACTTCAACCTGATTGGATCTTTTGGCAACAAATTAATTCCTAAAAGTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTCGTCGTTCTCCTGACGTGGCAGCCTACC
ATGCCACGACGCTACTTCAACCTGATTGGATCTTTTGGCAACAAATTAATTCCTAAAAGTTCAAAAATTGAAGAAATCTAAAATGAGCTGCCACTTCTTG
GGTTCTCATTCCACCGCGCATGCGATTGCGCCGACATGCGGCAAAGCTTGGTCGAAAAAGCTGCCTATTAGCTGCAAGAGCCCCCTCGCACAATGCGCCT
TCGATGCAGCTACGATGTGCTGCGAGGTATGCGCTGGAGGGACTCGGGATGGGGCCAGTCGTCGAACGTTCGCAGCTTCGTATGGTCGCACATGTCCGTA
CCGGTACGGGAAAGCTGCAAGCATTCGGTGGCCGGGATGAATCAGGTGCCCCGAATCTCTGCAAATCTCGGCGGGACTTATGAAGTCGACGCTTGTGATT
GGTTGGCAACTGCGTTGGATTGTAACCAAGTTGACACATACGGTCTCATAGCGCTGATTTCAGGGAGTATACCCTTGCCTGGACCTATCAGAGGCCGCGG
CCTGCTTCAACGTGCCGTCGGAGAAGTTAATATTCACCGGAGAAGGTCCTGAGCTCTCGTACAAGAATGTACCAAGCGCCACGACAATGAGGATAAAGCA
CGGTGGTGCTATCTAGCGTAGCAAGCCGCGTCCAGCGCTCCTCGAGGGCAGCGACAAGCCAACTGGATGTGAGGGAATTTCCCCTTGGAAATTTGCTTGG
TCCAAGCGAAGTTCGAAGATATCTAGAGGCTGAACGCACGCAACGTCTCGTGGCTGCCCATCCCCTG