Description :
From Genome Similarity Track
Location :
scaffold_906:8906- 10245
Sequence
1339 bases(100 bases per row)
AAAATGAGTTTTAATCATCTGAAAACACGAATACATACTTTTGGTGCATGTGATGACTTTAGGGGGCATGGCAAACTTTGCGAACCGATACCATTTGACG
AATCGTTTCAAACCGAACCATTACAGGCCATGCCATTCTGTATATTACATGTACTGAATATTTTTAATATTGCCAATGCAAATTTTGCAATGTCGTGTTA
TGTTTATTGTTCATGCACCCATCAGGGGGGGGGGAGGGGGGGGGGGGCAGAATTAGATTTTTGGTGGTGATTTTGTGGCCGAAATGTTGGTGATTTTTTT
TTATGGTCAGTGGTGATTTTATTTTCCGAAACGGTTCACCTGTTTGGGTAAACCATTTCGGAAATGGTCAGACATTTTTGAAAAAAAGACCATCCGCAAC
TGCAAGTTTCTCTTCAGTCGTAAATCTTCGGCTGCAGCGTGCACTACAGCTACCCACTCGTCTTACCCGCACCTACGCTGACAGTTATGTATACCTCCCC
CTACCATGGTGCTCTTTTTTCATGCTAACACACGTCTCTCATGAAACGAGCGATGAGCACCAGCGCCAAGGAGAACAAGAAGACGAATGTCCGTGCCGAT
TCATGAGTCAAGACCGCTGACAGCGCAACTTCGCCGTGCAGCAAGACTAGCTTGGTCCTGGAGAGGCGCTGGGCGTGCAAGACAAGATAGGAGAAATGAT
GTTGGCGCTGGAGTCGACGCTGGGAGCGCTGTTGATCGAGGCGTATTGGTTGTGCTGCCGAGCGCGGTAGCGCGGCGGCATGGTACCTGAAGAAAGTGCC
ACAGAAGGTGAGCCCCAGCGTGCAGAACACCTAGTGCATTTTCTTATAGCTGGGCAAATATACGCCTTGCAAACCCTCCACCCTTGTCGGCTACATGTTC
AAGTAGAAAGTTCAGCTATAGCTCTGCGCCTACGCTATCGAGTAACGAGGAATACCATTATGCTTCCGCGTCTAGAGCTATGCGACTCGCATTGTGAGAG
GCATGTTGTGGTTCAACTTGTGAGTTGAAGTTAAGGAGTGATCGTCAACACAAAATGACCACACGGACCGATACACCTCGGCCTGCTTTGACCGGGGTGA
TATTGTTTGAAAGGATTGCTGGTTTTGCCTCCTCCAAACTGGTGATATTTTTTGTACCATTTCCTAATCCTGACCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCTCATTCCGAGGCCGCCCAGAGAGCGCACTTTGAAAAAATCTAAAAATCTGATCCCAGGATAAATTGTATCTGAT
TCTATCGAAAACCTCAAGTTGTCGTCATTTTGAGCCATG