Description :
From Genome Similarity Track
Location :
Scaffold_30:890457- 894728
Sequence
4271 bases(100 bases per row)
AACCTAAGACGTATGCGCAACTTGTGGATGTATCCATCACAAAGTATACAAATAATAAGCTAAATGAGTCACTTGGTCCAATCTACTAGACATTGTGCAT
TTTACTTGTGTAATGCGCACAGGCATTCAGGACTGAAAAGACAGCTGTTGGCTCAAATCGCGCTGCGGGTTGAGCGCGAGGGATTACGTATAACATGGAA
ATGCCTCGCCCGACGCATGGCCAAAACAAAGCGTACTGATCGCCAGCTCCAGCTACGCCAGACCTGTCTCAGGCGAGCTTTTAGTACGCACATTAAAGGC
TTTCCTCCCTGCTTTTTTGGCTGTATTAGACCTACGGTGCGGCCACGATAAATGGATGTGACAGTACGGCCGCTTCTACAACAGTTACCTGCACCCGCAG
CGCCTAAGGCCGCGGTGGCGCTGCTTGTGCCAACATTGCTAGTAGCTCAAGTAGCGGATTCAGCAACGAGAGCATGTGTGGGGGCAGCGAGGGCTGCTGA
CACAGCGGGGACGCGGGTGCAGACGACGCCAGCAACGATATCATAGCCAGATTCAACACCAGGCACGAATATAATGTGTTTTGTTTCAAGAAGCAATAAG
GCTGATCATATCACGAGAGCTTTGTGAAATGGCAAGTGCGTGAACTCTCGCCGTGAGTTATTTCATTTGGCCAAGGCACCGCTCAGCCTGTGCTGAAACG
TTTGTACTAGGTAGACCTTCGTACGCAAGATTGAAGTGCTGTGCATTTGGAAATCATATATCTACAAAAGGAGATGCTTTGGATCCCAAGATATCGACGT
GTTGCGTTTTGAAGCTCTTATGATAAGCTATAGTATTAAACGTTACCATAGGCGCTGTGTGTATTATCACCACCATCACCAAGCATTTACCGTCACCAAC
TCGATGCTCGCTGTCGTCACAGCCGCCATTATAACGACAGCCGTCGTCACTGAGTCACGTCATGTCGACGCAGCTTGTACAGCTCCTTGGCCTACGTCGA
CGTATCCTCGCTGTGCCCAGACCACCGTCTCCAGCTTGACACTGATGCTCTACTTCCGGGCTACGCTCGCTGGTGGCCTTTTTTTGGCGTAGTTGCGGAT
ACTGCAGCAGGCTTCACCTTCACCGCTGCAGTCGACGGCATCACTAACACCGCCGTGGTTTGGCTGTCTCCAACCCATCGGTGGTTGACCTCGGTTTCAG
TTGACGAAGCTGTCTTCTCGATCCGTCGAGCATTGGCGGCGTTGCATTTCCACCGGACGCGTTCCGGAGCACCACCAACTCGCAGCCTCTCCGAAGGTTG
CCGTGCTTTGTGAATATCTTGCGTTGTGGGTAAAATACATGAAATCTTTGCCAACATGTTAGCGTATTATCTGGGCACGTCCAGGCCTTGGTCTCCTCAG
GGCGATGCACAATTGGGCATACAGTATACATACACTATGACCATAGCAAAACAGCGTTACCTTCCGTGGAGTACATACACTATGACCATAGCAAAACGTC
GTCACTTCCGTGGCGTAACGTCCCTCCCAACGACACATGATGCACCACCTCCGTTTACGCTGCTTGTCAGTGTAGACCTTGATGAAGCACTGGTACACAT
TGGTACAGGGCTTCTGATAAATTGGTCAAGTCCAAATTTGAAGTGCTTATCGACAGTACCACTCTATTCTCCAGCCAGTGTCCTTCTGCCGTAAAACGTT
CGGCCCTCGCTTGGAGCGTGCATCCAGTGCCCATTTAGTAGCTCCGTCATGCGTTCGGCCATAAAACGTTGATGTGGATCCCTTGCCGTAGATGCTGGTG
TCGCCAGGTGCCCTGTCAAATATGCGTTAGCTGTTACAACGTCAATAAGAGCGACTGCGAGTTTTTTGTGATAACTCTTATAACTGTGCGCATCCGCAAT
AAAAACACCCTCTAATTTGGCCCAGACAGTCCACGCCTTGCATGTTTTGATGTAAGATTTCACACAATTTGGGCCTGAGAATTCTTGCGTCGCGTTTCCA
ACCGTTCGGGTTACAGCGGGCCTAGTGGTGGCCTTGGCATTTGACAGCATGTTGACGATGCTACCATCACACCAAGATGCAGCGACCATTGCGTGATCGA
TAGCCACCGCCTGTCTGATTTGGCCACGAGCGCACTCGTCATCTTTGTCTAGCATCGTGTGTTAGGAAAAATGCTTGCTGCTCGTGCGTATCATTCCTCG
GCCATACAAACCCTTGGTTGTAATGCTTGAAGCATCTGACCGGAGCAGTAGTAACTGTCCATGTTACCCACTCAACTGATTCCAAAGAGCGGCCGTACCA
CTTCGAGTACGAATCTTTGAAACCTTCTTCAATTCATCGCTCAAATTTTGTATCTCCACATTTTCAACGACACCTTGGAGACGATCAGCGACGTCTCTTC
TTTTGCAATGCAGTCTATAGTTGAGGGCGATCCACGTTGTCGAACAACTCACCATGTAGAGTCGGAAGTGGTATTCACCGATGGTTTTGGGTAATTAAAC
ACAATCATGTGTCTGCCCTGGCGAGAACATCAAGCAACGCTTGCCACATCAAGAGCAGCGTCTCCCCTGACCACGACTTACCTTTCACCGGTGAATTCTA
GCAGATTCAGTAGTAGCCTGATTCTCGCGGCAACATCGTGGTTCATTGTCGGTGGGCTTACATTGAAGCTTAGGCAACGCCTAATTAGCTTGTACCGATT
CAATGCATAATACCGCCCAGCGAGGTAGACTTGCCGCTAAATATTGTATCCTCAGGTTGGCGGCCCCATTAATTCGCGTACTCGCTTTTGTTGCTCAAGA
CCATATAAACATGATGCCTGGGAAGCGCATTAGTTCTTCCATAGTGAACGGCTGGGAAATCGTAATCTCGTGAATGACTGCATACTCGTTCATTTCATGA
AGCACTTGATTCAAGAAATACGGTGGCAGATACGCAAGAAAACTGGGTCTGACACTGTACTCGAACCCGGGGCCTATTTCCGGGCGGAGAAATGCTTGAG
ACGAGCCGTCGATGCGCTGATAGCATCCTGGGAGGCATCGAAAGCTGCGTCACGCTCGAAGCGCATACTACGAATAGCCTTAACGCCTTGCAAGCTGGTA
AGGAGTAGCTCAGCTGGATCATAGGCTTTCATAACTTCACCTTTTTGGAGATCAGCAGTGTCGTCGATGTCGAATTCCTCCGAATCTCCACTTTCGAGAA
ACATGTGCCAGGTTGGCTAGTGTTGCCATTTCGGAAAGCTTTATAATTATCAAGGGCCATCCGGATCTTCCCCACCTGAGGTTTTTAACAGTTGACTGGA
ATTCGCTGTCGAGCCAGCGAATTTGGAAGGCGTCCTTGCATTTCTTCGCTCGTCGGCACACCTTGCCAACGACATATGCCGTCCTAGCTAGCTGGTAAAC
ATTCTTCTTCATCCATGGTTCTCGTGCTGGTGAGAGCGCTACACTGTCTACGGTAATTAGGCTAGGTGCGAAAATAGTCTCAGTTCAAAAGTAGTCTAGG
TCAGACTATTTATTGTTTAGCCAAAATATCGAGATTCATAAATATAGTGATCAACACAGGTTCATAAATAGTCTGACCTGAGCCGTTTGAAAAAGAGTGC
ATATTGGTACTCAGTACGGCTGGGTCATTTTTTTCTCACAAAACAATTGGTTATGATGTTTGTGGTTCTCGAAGTGCCGACCAAGTGCAAGTACATATAC
AACCCAGAATCATTAGAAGCTATGAAATGTCATACCCGCGAACGGCAATGATGCGATGCGGTCTGTCCCTCGGCATCGACGGGAAGTGGTCGGTTTCTCA
GCTTTACCCGCATCTCCAAGACATCATCAAGAAGCACGAGGCCCATTTTGAAGGCGAGCCTGTTGACACGGAAAACGCGTAGAAATACAGCAAGGTGGTC
ATTTGCTAACATAGATAAAACATTGAAAAGAACGAAAATTTAGTCTTAGTTGGAGCAGTCGTCTGAGCGACGACCCTCCACGCTGGGTTCGAGTCTCACG
TTTTGTGTATTTTTTTGTGACCGGTCGAAATTCATAAATAGTCTTAGCACTCAAATAGTCTGTGTCAGACTATTTAATGTGTATGACCTGAGAAACCATA
CGCACAAAATAGTCTCGGTCAGACTAATTACCGTAGACAGTGTACCAGCTGATCAATATATACGTCCTCCAGCAGCACCGGCGGTGTACGGGGTAGGGGT
GATTCCACAACTTGGCTGACTGACTGCACGTTTTTAACTAGATGGGGGTAGCGATAATATCGCTAAAGATA