Description :
From Genome Similarity Track
Location :
Scaffold_24:89020- 96941
Transcript NameFunction/comments
Physo_133067hypothetical protein
Physo_133068hypothetical protein
Physo_133069predicted protein
Physo_133070hypothetical protein
Physo_133071thioredoxin-like 1 variant

Sequence
7921 bases(100 bases per row)
CAACTGACGGAAACCCAGCGTCACCAGCCACGAGCAAAGGCTGACACGCTCTCACACACAACATAAACCTCGCAGACCCTCAGGAAGGAAGGGTCCCAGC
CAGTCACGGCTTGATACGAAGGTGCCGGAGCTATACTCCAACGGGAAGGATAAATGGAGTGCGCTCTCGCTCCTCCACTACACGGCGATGACTCGCCCTT
CGTATACACGGCCACTTCTTCACTACTCTTGGCCTGACCACGGGTAAACGAACGCTACGATACTAGCAGGCGCGTCCACCGACAGTCATAATCCTACCAA
CAGGTTTATCCAATTGCTACGGGAACTCACCGATAGCCCGGACGTCTTCCTTGAGTGGTTGGAAGGAAAAGCTGTTCTGTTCTTGTTGCCCAAAGGGCTT
ATCTGTTCTATCTTCTCTTTCCTATGGTTCAATACAAATATCTAGTATAAACACGTCCGTTTTGGATCTTCCCAAGTAACCACCGACCCTTCAGAGCCTC
CTCGACGCCCCAAGAGGCCTCTCGATGACTCTATTGGACGATGAAGACTTGGAGCAGTCGAACGGTCGTCTTAAGTGCGGATCTCGGGTCAAAGTTCGCT
GTAAGTTCGGATCGTACTTGAAGTCCTGGGTCTCGAACTTGGGTGTCGACGAGTCTTCGGCACCGGTCCAGAATGGCCAATCAGCATCCGCCGAACATTG
CTGAACATGTCCCTACGACTCGGGTCGCCACTGAAGCTTGGTCGTCAGCTCGATTCTCGTTTACCACAGCTCCCCCATGAAGCTCGGGCTGGGAGCCGAC
GCTGAGCGTGACTTGGATTCGCTGGTGGGCCACCACAACGCCTTCGTGACTCGCGGGACCCGAAAGGCAACTCGGTTTGTGTCAAGATTCATTACTAGCG
CTTGGGGCTCTGCACGAATCAAGCCTGAAAGTCATGACAGTCATTCCAAGGGACCAGAGCAGCCTACTGCGCACCACAAAGAGACCGCTAGTTCTCATGA
AGAGCTGCAGCTGGAACTGGTTGAGAGCACGCTCGAGCTGCTTTTCCACTGCGAGTATCACGCTCTCGTTGAGTACGTCGAGTATGCGGTTCCTATTCTT
TTTGGAGTTTACTTGACGATCTTGTGCCAGCTACCGACACACAAATACTACCCGCACACACGAGACATGGAGCCCAGGCAACTTGAATCGATGGTGGAGA
ATCTGTCAGTGTATGTAGCTCTGGAGGTGCTGTCGTTCGTGGTGATGCACATCGCGCTCAAGCGGAAATTCATGTTGTCGGCTCTATCAATTGGCGTTTG
TACTTGAGACGCATGTGGTCCAGTTGCAGAGCAGGATGTTCGTCTGGATTGTATTCATTCTCCAGTTCACGCTGCAATATTACGGCGTGGATTTTACTTT
CCAATTCGCCTGGATACATAAGAGTGAAGGGGGTTAGCACAGCAAGCTTTGTAACTTAACACCAATTTTGCAGTATGAGAACAATCTATCCCTGCATACA
ACATTACATTTATGTCGGAGCTAAATTCAGACTGACTCGAATTTGCCTTCGGGGGCTAGCAGCATGCATCTCAATCGTCTCGTCCAAGTCGCACCGCTGC
CCAGTATCGCTCAACCCAAGGACAAGCGATCTCACGAATAACGAAACATCTCGATTTCCGTGTTTTCCGCGATGGACCACGCAACTTCGTTATCTTAATG
TCTTGGTATTGCTGTGGTCTCGATGTGTTTCTACGTCTCGAGTGTGATGATTCTTGCGAGTATTTCGGTATTCCCCGTTCCATTTGGGCTCGTCTTCGGT
ACTGGTCCGGGATTTTTCATTTACATTTCGCTCTGTGTACTTGCTGTCGGTCCCAAGACATTCACAATGAACCCAGATCTGGTCCTCGAATATAAGAAGC
AAGTGCACGTGTTGATGGTGGAAATTGCGCTTTCCATGACCTATCCAGCTTTTTCTGGACTACATTTTAACGCCAATCCAAACTATCGTGTTTGCCTGGT
ATTACGGCTCCCGCTCACAAAAATCGCAATGAAGAACGTTGTGGCTTCGGCGTGCTCGCACTTTGAGGATTACATGCCAGTCATGACAGTTTTCTCGGTC
GAAGTGTTCAACGCCCTCTACGTTGCAACGTGCATGCAAGCGACAAAGTCCAAAGTGGCGGTCGGTGTTATTATCATTCTTGGTGTCGTCAACGGGGGGT
TCTCGTTCTTCGCACTCCTTGAACAAACTCGCACAGTTCAGCACACGCTGCTATACGATTTATCCAGCGACAAGTTGGCACATGGGGGTGACCTAGTCAC
GACGATGCTGCCAATTTGCCAGAAACTCCGAGCTTTTCGGACGAAAAAGGGCAAGTTGATTCAAATATGATCTCCATCGGACTGAGACTTGGAGAAGAGG
TGGAGCGCACACTGGACTCGCTAGTTGCTCAGGAGCTTTTGTTCTTGAACCACGAGACACGGAAAGCATCTGAATCGGCTCAGAGGACGTTGTCAGGCGA
GTTATTTTTCAATAACAACAGCAAGCACAAGAGATCAAGCTCCGTACGCACGAGTGAGACTGTGGCAGAGCGGCGCTACTCGCGGCAGCCGTCCTATCGA
TCCCTATCACCTGAGCAGCAGCACCTCGCTCTGGTGGAAAACACACTTAAGCTGCTGTTCCAGTGCGAGTATCTTGCTCTGATGGAGTACGTCGAGTGCG
CAGTTCCAGTTCTGTACGGCATTTATCTGTCGGTCTTGTGCCAGCTGCAGAACCGACAGTACTACCCACAGGTCCAGGGTATGACGCCCGATCAGCTCGA
GGCAATGCTGACGACCATGGCGGTGTACGTGGCGCTGGAGATTTCCTCCTTTATAGCGATGCACGTCCTTCTCGAGCGCAAATTCAAGCTGGCGGCGCTG
TTCCATGTGGCGTTTGTACTGGAGACACACGCCAGCCAAGTCCAAAGCCGCCTGTTCGTCTGGATCGTATTCATCCTGCAGCTCGCGCTGCAGCACTACG
GCGTGGACTTCACCTGCCGCTTCACCTGGGTGTCTTAGCCCACCAAGATGGCTACATTTCGACCACTTCAACGACCATCACTCACGTTCTTGAAGTGCAA
CAAGTGCAATATCTACCAATCACCAGTCCCAGAAACGTCGTGAAACGACCAATCAACGTCCGTTTCAGCGAAAACGGAGACTTGCCCCCAAAGGATCCAC
TCATTCTTCAACTTTCCTTCAACCTCCCACGCGTGACTTCGTAGCCCACCACTAAACCAATGAACCCGGATGTATTGAGTTTCCTCCTGGAAAACGACCC
GCTCCTCTCCACTATAACCCCCACCAATATAATGTCCCAGGCCATGGTGTCCTCCTTCTCTATGGACGTGTCGGCCTACTCGAGCGACCTGTACGAGTAC
CCCGCCACCAAGCGACCGGTCGGGGGCCTGCCCAACGCCTTCGTCATGTGCTGGGAAAACGTCCTCGTGCCCACCAAGTGGATGCACCAGCAGCTGGGGC
TCAGGTCGTCCCTGCAGGCGCTGCAAGCCGCCAAGCAGCGCGCCCTCCGCACTCCGAACCTGCAGGCGGCGCTGGCCGCAGTGGAGCAGGACCTCATCCA
ACTGCTCACGTCCGTGTCGAGCTACGGCCCGCTCTTCATCGTGAGTGAGGAGAGCGTGCAGTTCGTCGAGGCCATGTGCAAGACCTTCTTCCCGAGACTG
GCCTTCTGTCTCGGCAGCTCGACTACAATGACGAGTGTGCACGTGATTGGATCCCCCAGCAGATTCCAGTCCGCAGCGGAGAAGGCGGCGTGGAGAGTCA
ATCTGCTGCAGAGTCTCTGTCGTGACAGACTCTTCGGCGGAGCGCCGCAGAGGCTGCTGGACCCTCGAGCAGGCAGGTTCGGACTCGTGGTGGTCAGTCC
GCACCAAACGGACATCGCGGCATGCGGCGACACGTACAAGGCCGCTCCGTTCGTCGTGTCCAAGAGCGTCCACGTGCAGAACGCACGGAATTTGACGCTC
GGAGAGTTCACGCTGCATCTGAGGACTCTGGCGGAGTACGTGCCCCAGGCTGCTCCGTGCGACACCAGCTTCGCGATTCAGCTCTAGCTCATCATAAGCT
TGAGAGATTCAACTAACTAGAGGTACCAGTATCGACGATAGTAAAAGGGTTTTATGGTATTGCTGACCGTGAAATGTCCGACTTATTGTTTATATAGAGA
CGTTATCGCCTAGCTGAGCTGAGCTGAGCTGAGCTTAGCTCGCTTGCGAGGGTGTCGGTCGTCTCTGCTGGCTTTGCTGCCAGTCTTGGTGCGCCAATTC
CATCTATTAGGACAAGAGGGTCGTTAGTTTGACGCCGAACGTGCCATCGCTTTCCGTCGACGAAGGCGGGTTCGCACCTGCTTGAAGTGACTCGCGGCAT
CTACCAGCGCTGCGTCTGTGGCTCGTCGAGCTCGGGTCAGCGCCGTCTTGCGCCTCTCGTGGAATCTACTGGCTGCGTCGCTCTGGATGGAGTCTCCGGT
ATCTGCGAGTTGTTCCCGAGTCCGTGACGTCAACGCAGTGAGTTGGAGCTTCCACTTGGTCATGCGCTCGCTCCGCTGCTTCTCGTAGTCTGCGAGGCTG
AACGTGGCCTTGTTCTCTGCTTCGAACGTCTCCTGCTTCTCGAGAAGGTCCTGCTCGTGCTGAGGCAGCTCGACTTCTACCTGCAACGCGCGGTACTCAT
CCATGGGCGAGTGGAGAGAAGGGAGCGGCACTACTGCTGCGTGGCTCTCCGATGCTATGCTGCTACTCCCAATCGACGATGAGGTCGATAGTGGAGGAGC
TTCAACTGAAGACATCGACGCCGGCCGACGGACGTCATCAACCTGCACCAGATTCGGCAACCTCTCGAAGAAGAGATGCGCGTTGGCCGGCATATGCCGC
ACGAACGGGTTGCCAGCAAGACGCAGGATACGGAGGGACTTGGGGAACTCGCTCACGTCGAAGTCGTCGATGTAGTTCATAGACAGATCCAGGAACTTAA
GCTGCAAGCAACAGGATGATAAATGTCAGCCTGAAGCCACACCTAAACGATCTCAACGCGAAGAATACTACGTACATTAGGCAGGTGCCGGAGGTTCTTG
ACTTCTCGGATGCGGTTGCCCGCGAGCGCCAGGAACGAGAGCTGGTCGTGGTCCTCCAGTCCTTCGATCGTCTCAATCAAATTGTACTGCAAGTAGAGCT
CCTCCACGTGTGTGAACGCGTCGAGGTTGTCGATCTTGCCGATGTCGAGCCAGTCGAGACGCAGCAGCTTCTTGCTCAGCATGGCCTGGATCTCCTTGTC
CTCCTCCTCGGGCGTCCGCGCCCGTCGCGTTGGGTTCCTGGCCATCGCGAGACTCTCGCGGATGAGCTTCATAGTCAGCGGCACTGGTCGCTCGCTCTCT
CGCTGCGTGGAGACGGCGACTCCCTCGATCGCCTCCTCCAGCGCTGCCATCTCGGCGTCGGGGTCCGCCTGCTCCACCTCCGCTTCGTCTTCGCGGCCCT
CAATGCTGCAGGTCTGCGAGGGGCGCGTGGTTTTCAGTCCGAGGCTGGCGAGCCACCGCTTGTCCCTGGAGGCCATGACGCGCTCGATCGCTCGCTGGTC
CTCGACGCGCTGGACGTTCAAGGTCGCGAATAGCTCCATGACTCAGCTCAAAGCTCGCAGTCGGATGGAAAGCCTGCGACGCACACGGCTATGCAGAATG
CCCTCGAGGCGAGTCTTTCAGCCGGCTTCTCGTTCTCTTTGGACGATCCCATCCGTTACTCCAGGTGGGACGAGGCTGGTAACGGCAGGCAGGGCGTCGA
CGCACCCCTCCCTCGGCTGGTCATGTTGAAGTGCTCCAGCCAATCAGAGGCGGCGGAGACGAACTTGAGCCATGCCTCATGTGAACCACGTGGCCACTCT
GCAGCTGAAGCGTGAGGCAGAGCTAGTGGCTTGCGAGCGAGCGCAGATCGACCTTATCACTGTACGGATGCAGAGCTGCTGAGCTGTGCTGCATGGGTCA
AGTCCAAACCCCATGCTGTCCAAATTTAGACCCTTTTCTATTTTTTTATATTGCGTCCAGGTGTCGTAAAGGTGTGCTGGTCTGGTGATCTTGTCCTGCT
TGGCTGGCTGTTCCACTAGCTAGGGTAGCTCTATATCTGGGCACCATCGAGACCCGGGTCAGACCTCTCTGGATGCTGCTAGTCGCCGGAGCACACGCAG
CTGCACATGGCGCTGTTCTCCGACTGCTGGAAGAGCCGAGGCGCCACGCTCGAGCGATTGCAGCAGCTTCTCGAGTACGTCCAGCGTCTGCATCCACCCA
GCCTGGCGCCAGACTGCGTTCTTGTCTATGGCAATGACTGGCCACCCGCCCTGACTGACGCCTTCTCTATGCATGCAGTGACGCGGAAGACCAAGCTGAG
ACCGAGCGCAAGGCCGCGACCCACATCCAGCGGCTCTTCCGAGGACAGCGAGTTCGAGCTGCTGTCACCAGACAGACGTAAGCTTTTGATCTCTCTTGGT
CTCCTACCACACGGATACTCACCGGTTGGGTCTCTTCAACTTGATCTTTTTTATGTAGGGATGCCGAGCTGATGATCTCCCGCGTGTATCGCGGCCACTT
GGGGCGTCGGCGCTGCAAGAGGCTGCGCGCGGAGCTGCATCGAGCTCATCGACGAGCAGTGCTCGACTACTACGCCGTCGTCATCCAGAAGCTCGCTCGC
GGCATCCAAAGTCGAGAGCATTGTCTGGACTTCCGCAAACGCAAGGCTTACATTAGCGAGCTGGCCGCCAAGGGGGACAGCATGCGTCGAATGCTGGAAG
AGAACCTGCGTATACAGCAAGAACGGGAGCAGTTAGCAAGCGAGCAGGCTGCGAGGGAGGAACTGGTCAAGGTCACGCAAGACCTTCACCACCTCGTGAG
CACGAAGGCTGTCGCAGGGATCTATAACTCGCCCATGCAGCCCGCCAGCGCCACGAGCTTCGGCGTGCCCGTAGAGACCCATATAAGGGAAAACGCTCGT
CGAGTTGTGTCCACACGACTAGCAACCGCCAGACCGCCGTCAAGACTGACGCCGTACCCGCCTTCTAACAAAGTAACTCTGCAAGCCACAGCACCCTATG
ATGCTGTCCAACGAGAGACACGGAAGCAAACCAAGTACCACAAGTTGAGACGCATCGGCACGACCGACTTCGCAGCCGTGTACAACCCAGAGCAGGACGT
CGCGCGGAAACTCAACGCACCTGGAATCAACGCAGGCATCGAGTACCTGGACGACTGGAGGAATCCCTACAAGAAGCGAGGCGTGCCACGCAACAAGCGA
GACCTGCTGCCGCAGTTGTCCACTTTAGGCCACGCACCCGAGACTCCGTTCTACTTGACCTACGGCGGCAACAAGAGTAAAGTGCTGGCCAATGACCGCT
TCGACGTGTAAAGTAACTATTAAAGAATAAACACATCCAAATATGACACAGCAAAACCATGCATCTTGCATGGATACTGTGGCTCAAAAAGACACGCGAT
TGCTCGAGTGGCTTCAAGGCAAGTTGATTTTGACGTCTTATTCCTCGCTGACCTTCTTCAGTTCGTTCATGTTGGTGCCCGCCAGACGTTCACCTAAACA
AAAAATAGAAGCAACAGGTTAGTATACACCTAAACAAATCGGCAACAACAAAAAAACAAATTTTGTTGCCAACCCACCGAAGAATTTGAGGCTGGAGATG
GCGGTCTCCTCGGCGCCGTTGTTCTCCTCCACGAAGACGGTGATGCTCTTGACGCGCTGGAACTTGACGAAGCGCAGCTCCACGTCGTTCTCGGGCAGCA
GGTCCTCCTCCTTCAGCTCGATCGTCTGCGTGGGCTCCACGTCGCCGGCGTCCGAGAAGCCGAGGTTGGGGCGGTTCACGAAGAGTTTGATCACGCGCGG
GGCCTCCTCTCCCTGCGGGGC