Description :
From Genome Similarity Track
Location :
Scaffold_53:89014- 92045
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16032callose synthase

Sequence
3031 bases(100 bases per row)
GGTGCTGGTCAATGTGCTTGGTCCCTGCCACGCGAATGATGTGAAGTACATTACAAGTGTGCTCAACTCCTGGGCGGCACGTGGTGTATTCCGTGCGCTT
AACTTGCAAAAGGTGGCTCCGTGTGGCCGCGCTTTGGCGGGATTGATCTCCCTTTTGAAGACCAACGTCCGTGGCTGGAAGAACAACGCCAAGGTTATCC
CTGTGCGCAAGGATCCTTCCGATTACGCATCGTATGAATTCCCGCAACAGTCTAGCTCCTACCGACCATCGTCGGGAATGACGAAGTCTGCAAGTACGAC
GGGATTGTCGTCGCTTGGTCTCGAACCTCCTCGCCGTAGTCGTGGTTCTGGAGTCGCTCGTATTGCACGTATGCAGCAGCAGACGCACAAGCCGGCCACC
AACAATGGCAAGGCCACGCACTCCATCTCGAGCTCTCACATCATGCAGATTCGTGAGCGTGTGCGTACGTTCTTGAACCTCGGAAAGGAGATTCTGGCAC
ATGTCCACGAACAAGACCCCGTGTTCGCTGAAAGCAAGGGCATTTCGGACCGGTTGACGTGGATCCTGACACAGGAGCGTGGTTTCATGTGGGACGACAA
CTACACTGGAGAGCAGATCACGCTTACAGCGTTTGAAAGCCACACCGACGTGGTGCTATCCCACCTACACGGACTTTTGACCTTGCAGAAGATTGATGCG
GAGCCACAGTCGTACGATGCACGCCGCCGCTTGCTGTTCTTTGTGAACTCGCTCTTCATGGACATGCCACTGGCGCCGCTGCTTGAGGAAATGAAGTCGT
GGAGCGTCATGACTCCGTTCTATGCCGAAGATGTTTTGTACTCCAGAAAAGATCTGGAAAGCAAGCAAGATGGTCTGGACGTGCACACGCTGTTGTTCTT
GCAGACGCTGTACAAGCGAGACTGGGAGAATTTCTTGGAGCGAGTGAAGCCAAAGAAGAACATTTGGAAGAACCCGGAGACTGCAATCGAGCTGCGCATG
TGGGCGTCTCTGCGTGGCCAAACACTGTCGCGTACGGTGCAAGGAATGATGTACGGTGAAGCTGCGATTCGTCTGCTTGCTGAGATCGAACAAGTTCCGC
AGCAGAAGCTTGAGGAGCTGATCAACACCAAGTTCACGTACGTTGTCGCCTGTCAGATTTATGGACGTCAGAAAAAGAACAACGACCCGAAGGCGAGCGA
TATCGAGTTTTTGCTGCACCGGTTCCCTAACCTTCGCGTAGCTTACATCGACGAGGTCCGTGTGAACTACCAGAAGGAGCAGTCGTACTTCTCGGTGCTG
ATCAAGGGCGGTGAGGAACTTGGCTCGGTTCATGAGATCTACCGTGTGCGTCTGCCTGGCAATCCCATCTTAGGTGAGGGCAAGCCTGAGAACCAGAACG
CAGCTATCGTGTTTACGCGCGGTGAGACCCTTCAGACCATCGATATGAACCAAGACGGATATCTTGAGGAGAATTTGAAAATGCGAAACCTACTGGAAGA
GTTTGACAAGGGTACAGCGGACCGGCCGTATACGATTGTGGGTATTCCGGAGCACATTTTCACGGGTAGTGTGAGTTCGCTGGCAAATTATATGGCGTTG
CAGGAGACATCGTTTGTGACACTGAGTCAGCGAACGTTGGCGCGTCCACTGCGTAGCCGTCTGCACTACGGTCACCCCGATGTGTTCAACAAGCTCTTCT
TCATTACACGTGGTGGTATCAGCAAGGCCAGCAAGGGCATCAATCTCAGTGAAGATATCTTCGCTGGCTACAACAATTGCATGCGGGGCGGATCTGTGAC
CTTCCCGGAGTACACGAAGTGCGGCAAGGGACGTGATGTTGGTATGCAGCAGATCTACAAGTTTGAGGCTAAGTTGGCGCAGGGTGCTGCGGAGCAGTCA
CTGTCGCGTGATGTGTATCGCATTAGCCAACGTCTCGACTTCTTCAAGCTGCTATCATTCTACTACAATCACGTGGGCTTCTACCTGTCGATGTCGATCA
TCATCTGGACAGTGTACATCCTGCTGTATTGCAACCTGCTTCGATCGTTGCTTTCGGTGGAGGGTGTTGGCGGTAGGGAGCCAGTGTTGTTGAGCAAGTT
GCAGTTGATGCTCGGATCTGTCGCGTTCTTCACTACTGCGCCGCTGCTGGCGACGATTTCGGTTGAGCGTGGCTTTAAGGCCGCGCTGAACGAGATCATC
GTCCTCTTCGTGACCGGTGGTCCGCTGTACTTCCTGTTCCACATTGGCACGAAATGGTTCTACTTTGGACAGACGATTCTTGCTGGTGGTGCCAAGTACC
GTGCGACGGGCCGTGGTTTCGTGACGAAGCACTCGTCATTCGACGAGCTCTACCGCTTCTACGCAAGCAGTCACTTATATGCTGCAGTGGAGATCGCGAT
TGGTCTTACGCTTTACTACAAGTTCACTGTCGGCTATCAGTACTTCTCGATGACATGGTCACTGTGGCTTGTGTTCGTGTCTTGGTATTGGTCGCCGTTC
TGGTTCAACCCGCTGGCGTTCGAGTGGTCTGACGTGATGGAGGATTTCCGGTTGTGGTTCAAGTGGATGCGTGGTGATGGTGGTAACCCAGATCAATCGT
GGGAGGCTTGGTTCAAGGAGGAGAATGCGTACTTCTCGACTCTTCGCCCGTGGTCTAAGGCATGCATCACGACTAAGGGCGCGTTGTTCGCGTTGATCGC
TGTTTCTATCTCTTCAACGAGCGACGAATATCACTCGATCTTGACGGAAACCACATGGCTCCCGCTGGTTATCTGCTTATCTATGGCCGCGGTGTATCTA
AGTGCAGAGGCTGTCTTCTTTTCCTCGTCGCGTTCAGGTGAGAGTGGAGTTGTCCGCTTTCTGAAGCTCATTTTGGTGATCGTCCTGGGTGCTGGTCTTA
TTTTCGCCTTCATCTACGTGGACGGTATGTGGCAGATGCTGCTGAGCATGGGATATCTCGCTGCGGCTGTCGGTTGCTGGGCGCTTGTGCTTCTTGGCAG
CAATTCGCGCCTTGTTGGTACCCTTTACTTT