Description :
From Genome Similarity Track
Location :
Scaffold_110:8901- 16206
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_110-snap-gene-0.16Conserved gene of unknown function
Pytir_DAOMBR486fgenesh_masked-pir_contig_110-abinit-gene-0.53FGFR1 oncogene partner
Pytir_DAOMBR486maker-pir_contig_110-fgenesh-gene-0.9Transcriptional regulator

Sequence
7305 bases(100 bases per row)
CGAGGGAGGAGGAAAATATGTACTGAGGGTACTGTAATTTTCATTCGAAAAAACGCGGTTTTTCTCCCTCGATTTGTGCGAGTACCAACACTTGCAACAA
CAAAGGCAAACATATGCTTGCTTGCTGCCGTCGCCATTGACGAGCACACGTCGTCGCTAGCACGTGTAATGGTTGTTACTGAATTACGTCTGGAGTCTCA
AGCATATGACTCGGGCGGGGGAACAGAATGCACCGTTCATTGCCCTTGTCTGTATTTTACGAGCTTGCTTTTGCGTGTGTATTTTTGTGTGTGACGACAA
TAAGCAGCGTATTTTTCAGTTGATGATAGAAAGGGCCACTTTGGCAAAAAAGATGGCGCGAAAAATGGAAGGCGGCTTTGCAATTTTGGCTGCAATCGGG
AAAAGCGGCGGCTTCGATTTTGTTGCCTTGTTTTTTGTGTTTTTTTGGCTTGACTATTTAAGCCTGAGTGAGGCCAATTCCACTTGACCCGATGCGAAAG
GCTTCTTTTGCATTCCAAGAGTAGGTATCAGACGTGAAAAAGAAGAGCAGCATTTGAATCCATGGACACAATATTAGAAAAACCGAGCCAAACGTGCGGA
CATTTGTTCAAATAGAGGTTGGCTCGGACTCGATAATAATATTTTAGAGGTGAGATGGGCTAGACACTAGATGAGGAAACGCGAGCCAAACGTGTGACAA
TGTGGGATTTATGCTTGTAGCAAAAGTATAATTTTATAGAGGTAGGAAGGGTACGCAAACCCTATCCGCCGACGTCTTTTTTCTCGCATCAGCTGGCCTG
TTTCTGTGCCAAAGTCTCTTGCGGAGGTGCGCAAGAAAATGGCGGAGACGCGTAACTGTCTATTGGCAGTAGTGCGCATACAATTTCCCATACAAATCTC
AGGGGAACCAGCGCGCGCGGCTCATCACCAACATCTGGCGCGCCACGGCTTGAGCCTTCTGTTCCCCCCATTGTTCAAGCCTGAGCTTCACTGTCACACC
CGCGGTGGTCGTGTTCAGTTCTGGCGTAACCTGTGCGGTTATTCAGACCAACAGCGAAAATGGAAGCGAGAAGAACAGGACACACACTTAACGCTCTAGC
AGGTAACAAAATGGCAATGGAGCCATGGATATATTATGCGTGGCTGGCTGCTTGTGCTTCTTTGTCTTCTTCGCTTTCGCGACTTCTTCACTCCACCCAT
TGAATACCGTAGAAAAATAAACTGAAACCGTCGGAACACTTGACTTTTCTCGTCAAGCGTGGCTGCTCAATTGCGGGTTACACATGATAAGGGGGTTATG
AAACTGTCAGCACTGGGTACGCTACCTGAATGAACCCACTGCGCGCCTTTACGGTACACTGGCCGTTCCCTATCCCCAACCAAACCTGGTGACTAAAACC
TCCGCTCCGATATCCCAGACAGCTTCACACTTGATGCCTCTTCGCCGAGAGGAATTCTTGTGTGTGCGTGTGTGTTGAACTTGTTTGGTTTTGTGAGTAA
GGTGAGCAAGGCGTTTGCCACTTGGTTTTGCAATTTGCAAAAATCAAGGCTTGCCAGGACGCAAAGCAAGCAAACAAAGCGCACTCTTGGTGTTGCCAGC
AGATTGCTGCTCATGGTGAGCAAGCAAACTTGCACTTGCTCGGCTTGCGTGCGCAAGAGGGGAAAAGAGCGTGTGAACCACAACGGGAAACCCACATCAA
AAGGGCGGTCCACAACCTCAAAAGCATGGCTCTTTTCGACAAAGAATTCGGGCCGCTGACGTGCGTCAGGTTTCGCAAATCTGCAACTGCTCCTCCCCCT
GACTTGCTTTCACTATGCCGCAGGAGACGCGGCGACACGATGCGACTTGCTTGGTTCGGGTGACGAGGATGATGCTTGCTCGCGCTGGTCATGAGTGGTG
GTGGAGGGCCGACGGGTTGGCGCTTTATCAATGTGCTCACAAAGATCAATAAAGTGGCGTCATGTGGACGAGCAAGTGGCTTGCAACTAAGTTGACTTGC
GCTACTGGTGCTGCGTGCGCGACATCTCACAACCCGCGCAAAGAAGAGAGCACGAGTGCCACTTCGAGCCTGTAATGTTATGTGATGGTTTGTATTCTGG
TTGTGCTTTGGTTGTGTGTGAAGGTGAAGGATTGAAGTGTGGCGATGCAAATTGATGCAGCATAGCTACAATATCCTGCCAACACGCAACACTTGTGGTG
TCTGACGCGCGAAGCAGAAATCGCACGGCTTTGCAGTTACTGTGATTGCATACATTATTTGCATTACACAAGTCCACACACAGTACATATACGTACAGTA
CGCAATTTAGTTATTTGAGTGCACGTGAAAGAGCTGTACAAGTGTACATATTTACGCGTACCCTCGGTACAGTAAGCGCTCGAGTGTACTCTTGTGTGAA
GATGATGACCCTCATGCGAATTAACAGACAGTTTGCGGTCTACACTGTCCATGTGTCCATTGATGAGCGAGGTGCACACACTCAGGGCACACCTGGGACG
CGCCATTATTGCTGACAAACGCACACGCCGCATGATCTTCCATTTTCGTTCCGCAGCACTCGCGTAACGAAATCCTTTTGTGTCGTGTGTTGCTGCCTGC
AACCGCGACGGTTCTCTGTGTCAGCCATCCAGCTCACTTTGCAAGACTCGAAATCTCGCGTCGCATTGCTCTGAATGAGGTGAACAACCAACGATTTTTT
TACTTACTAATAGCATCAGTACATCAGCACGCCGCTTTTAGAGAGTTAACAAGCAGATTCATGTTTCCAGAACAAATTAATAAAAACTAGCAACAATGCT
CGTATTTTTTGGTCCCACATGAAACAATTTAGCACACCCTGTGGAACGCCTCGAGCAACCTGTGGTGGATTGACAGACAACACTCAGGAATCCGAAAGCA
ACTACAAAAATGGCAACGAGAGGCATGATGACCGGACTGCGCAGCGCGCGTCGCGCTGTGGCCACCGCGGCGCGTCATCAGCGATTCGCGATCAGCGCCA
CTCCTCTGCAGATGCGCTGCGCGGTCGCTGTTTTCCCAATGAACAGTGTCTCTGCGTCCTCGCCGCTGTTCGCGCACACCAAGTTCATGTCGACCTCGAG
CGCGAAAGCGAACAGCGAAGAGCAAGATGAAGACGACCAAGGTATCACCGCGACGCAGAAGCCGCTGGAGCCGGTGCTCGTGTACGAAGGTCCAATGGCG
CGCGCGGTGCGCCTCATGAAGGGCGTGTCCGTGACGTCCTGCATCCTCACGTCCATCGGCATGCCGACACTCTGCCTCATCAGCGAGCAATCAACCTCCA
TGGTCGGCAAGGTGCGTCCTGCAGTTGTTGCACTGTATATTGCTTGCTTGGCTGATGGGATCTCTTAGTGCTGATATAGTTGTGCTGTTTGATGTACTAA
CGTGGTGCGCTGTGTTTGTTGCGATGTACGTCTTCAGTGGGCGATGTGTGGCACCATCATGGTACGTTATATGAATGAGCGGAACTCGACACCTTTGCTT
GCTTTGCTGTATCCGCGTTCACTAATCAACTCTATCATCATATTATCCCATTCCGTACAACTGTAGCTCTTCGGTTTGGGCACGACGTCGCTCTTCCACG
TGCTCTTCAAGCCTTATGCGATGCGCATGTGGATCACGAATGGCGAGAGCACGCAGAGCGTGGCCGACCCGGAGCTCACGGTCGAGACCGTAACGCTCTT
CGCGCAGCTAACCAAGCACCACTTCAAGCTCTCGGACGTGTCGCCACCTGCGAGCTCAATGCATCCGATGCTCTCGTTCCAGGCCAAGGGCAAGAACTTC
TTCGTGCACCCCGAGGTATTTGAAGACCGCGAGTTCGCGGAGAAGCTCATCGGCAAGAAGATCGCGCCGCGAAAAGAAGAGGAAGACGACGATGAAGAGT
AAGTCCAAGTCAAAGCAGCCAGTTTCGCATGCGCCTTGATTATTATATCTCTCTTGGAGTGTAAGGGCCACCAACACAGAACCCCAATGAAAATATAGAC
GCGCTTGTATGGATCTGTCTCCCAGTCTCTTACCAGTCCGTCTCGACTACTTCGATGTAGTCGTAGCTGTTGAGCGCGTTCTCGTCCTCCACTGGCCTGT
CTTCGTGGAGCGTCTGAACTGCTTCAGGTTGTGGTTGTGGTCGTGGTTCCTGCTGCTTTAAAGTGAAGAGCCCTTGGGACTGAGACTCGTCATTGTCAGA
GAGCAAGTCGGACACAGAGCCGACTTCGTCGTCCGATACCTCACTAAATAGGACATTAGGACGGACAGCAACAATGTTAGAACACTCACAGGCAGCCACG
CATTTCGTTGATGCCGCCACCAGCTGATGAGGTTGATGCGAATCCGGTCATTTGTTGTGCAGTTCGTACCTGGTCACCTCTTCCTCTTCAAAGTCGCTGC
CGTACCCGTCGTGCTCCTCCGCATCATCATCATCATCGCCGCCATCGGCCGATTTGCCTCCAGCCCCACTACTCGTCTTCTTCAAAGCCTCGTCATCCTG
CTGCAGCTCCATCTGCAGACTCGCCTTGAGCTGCTGCAGCGTGCCCGTTTCGTCCTCGGCCTCCATGGCCTTGAGCTTTGCATCCAGAGAGCTGAGGCGC
GCGGCTTCGAGCTCCTCATCAAACTCATCGTCGTCCAGCAGCGTTCCTCGTCTTGAGCTGGTGATGTTGGAGCTGCTGGCAGATGCTGCGATTGGTGGTA
GTGACGGCGACAATGTTGTCGGCACTGGTGGTGGTGCAGCCTCTTCATCTGACTCCTCAGCCTTTTCATCTTCTTTTCTACTATCACCATCCTTGTTGTC
GCCACTGTCTTCATGTTCTTCTTCCTCTCGAACCCCAGCACCACGAACACTCGCTTCAAACCCGTTAGCACCGCCACCAGCAGTAATGCCTCGTTTTGCG
TTCTTTTCGTTAAAATCCGCCGACTCGTCCTTGCTCGCAGAATCGTAGTCCTGGCTGTAGTTCAGACTCGCTGACTGCTCTTCTGCGATCGACTCGCTCA
ACTCGGAGCCGCTGACAACTTCGTCCTCATCTTCATCATCGTCCTCATCTTGTTTTGCCAGGCTCGCGTTCAGCTTGTCTTTCGTGTTGCCACTGTTAGT
GGCATTCTTGTACGCTTCTTGTTCCTCCTCCTCCTCATCGCTTCCCGACTCGTTGGCTCTCTCATCCACACACTTTGAGCTGTTACCAGCAGTAGCAGTA
GGAGCAATTGTGGGGACCCGTTCGGTGTTGTGCTTCTCACCCAATGCCACGTTCTTCCTGCCAAACTCATCCGCTCTATGACGACTCGGAGAGTTGAAAT
CGCTGGGGAACTGGTCCTGCTTCTGCTTCTGCGTGTATTTTGTGCCATCTTCACCCAGCCTTCCATCTCGACTCATACGATCCTTCGAAGTCTCTGAGAA
CTCAGGGGGCTGCTGAGGTTGCTGCAGCAGGATCTGAATCAGCAGAGGAAGTCGCTCGTGCTGGTGTTGTTTCGACCCATAGTCTCTCTTGTAATGCTGC
TCACTCAACCCGAGCCGCTCGCAGAGCTTGTTCAACTGCTGTTGATACTCTACTTCCTGTCCAGCGCTCTTCTCTGCGTTTGCCTCGGTCCTGAGCACTG
CGAGCGAGTGCTCCAGCTGGAAAAACGCGAGAAAATCCATCACAATGGCGAGCGCCAGTGCGCCGTCGTGCTTGAACTCCTGCAGCTTGTTGTTTGTCAC
GAGCAGCTCGTCGTCCTGTTCGCGTTCGTGTATGACGTGGAAGACCGCCGCGCGAAGCTGAGCCTACACAGTTAACAAGATGCATAAAACTGTCAGAGCT
TGGACGTCTCCTAACCCAGCATGCGAGAATAACGATGAGCCAGCGAGCGTACCTTGATCTTGCCCAAGACGCCCTGGCTTGCGAGCGCCTCGGCCACGCG
CTGCTTGAGCTCCAGCTCCTCGGCTGTGGGCGGCAGCTGCATCGTCAGAGCCAGCGTCATGGCAGACCACAGCGTTCACTTTTTAATGGATGACTCCCCG
TTTGGTTGATCGGTGCTTGTGATGTTGTGACCCTTTAGCAGACTGACCGCTCAGGCAACTCTCCCTTAGAATAGCGGAAGACACCCAACACACACACACT
GAGCTTGCTGCACTTTTGCACCGGGGCTCTCACTCCTGTTGTTTCTGATAGCATAGGTGTGTGAATATATTCATCGGCCTACATTACATACGATCCAACA
CGGCCCGCTCAACCCAAACGATCGGTCTCATCTTCAGTTCTCATTGTCTCCCCATTTCTTGCATTCGGCATCACCCTTCTTGCTTGGTCCATTCATTTTC
CATTCTCTTGTTTCCTTCTCGCTGGTGTCTCTTGTTGTCTTGTGAGCTTACGCCCAAAGCTTGTTCTTGCTCTTATAGGATTGATCACTTGAACTCGTTG
CTTGTATTCACTATTGTGCCATCGCATCATTGCGTCATGTCGATGCAGAAGATCGGCGCTTGCCTGCTTGTCGGAGCGACTCGCCGTCGGCGCAAATGTC
GTCGTACAGGCGCTCAAAGATGGCGGACGAGAACGGCGTGTACTCTGCCGCGTACGCCCACAGGCTGGAACACAGCTCGTCCCACTCGTGCTCGTCTGCT
TTCTCGCTATCCTTCTTCTCTGCGCGCTGCACAATCTCGTCGATCGCTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNCACGTACTTGAACACCTTCTCTA
CCACCACTTCGTCCTTCTGGTTCTTGGACCAGTCCGCCATGATCTTCATTTTCTTCAGCACCTGCCGGATATCCTTGAGCTTCCTGCTCGGCTTCCACTT
CTCATAGCACTCCTCTTCTGTCAGCAACCGCTGTTTCTTCTTCGACTTGCGCGAGAACCGCTCCGAACTGCTGCGCTTGCTCTTCTTGCTCCGCGGCGAG
CCGTTGCTCTGCTCTCTCTCTATGGACGCAGATCGCTTCGTCGATGATGATGAAGATTTCTTTGACGACGACGAGGAAGAGGAAGACCGTTTCGCAATGG
GGGCGGCAGCTGACGAGGGTGACACCTTCGCACCAACCTCTCCGTCTTCAGGCTCGTCGTCACTGTACGCTGTTGATCCGGTTGAGTTGGAGACAGCCGC
TGCTGATGCCGCGTTCGCAGCGATTGCAGGAGACGTGACCGATGGTTTTCTATGTCGATCCGACGTGCTGCTGCCATTGCCACCACTGCTGCTCTGCGTG
TTCGAGCGCCGAATTGAGTCTTCTGGGACAGCTGCTGCTCGCGTCGATTCCGAGCCACCGGTGGTTTGACGCGCAGCAAACCGTTCGGCGGCGCGCTGCA
AGCGT