Description :
From Genome Similarity Track
Location :
Scaffold_933:8900- 12006
Transcript NameFunction/comments
g16110.t1hypothetical protein
g16111.t1hypothetical protein

Sequence
3106 bases(100 bases per row)
ACTCGCAGGCCCCGCTTCAATTACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTACGCAAGACAACAAGCGGAG
GACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAAGTGACAGCCAAACAGACGGCATGTCTGTTTGTC
GACATGGTGTTTAGACACCATGGCATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTT
GGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGTTGGTTGACACCATGAAGAGCTACGCGCA
CTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGTCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCC
ATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGA
TACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGAGCGTAGACACTTTAAACGAC
AACGAACATCACGCGCAGGCCGGGCCTGCTGCGACCAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAG
CCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGATGAATGCCGATAACACCGGCAGGGGAAACACAAATGAATTCAAAGT
TGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGAAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACC
GTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGATGGGCGACTGAAGCCGTACGTGCAGC
ACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGTCCCCACCTCGACCTTTACGTTC
GAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGGGACGCTTGGTGACGCTCAACAGCCTCCA
AGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTT
GATCATCGGAACCAGACCCACGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGATTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGG
AGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCGCCACTGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTC
GGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCGTCAGGTACACACATGAACGTGTACC
CGTTGACGTCCCGCTCGGTGATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGCACTGTCATAAGGCACTGCGCAAGGAAGTCCAATACCGACTGCACC
ATGGTGCAGTCGTTCAAGTTTACCACGCTTCGAGAACTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCGGTCGCGATAGCCAGCGGTTTTTTGTTGTTGA
AGTTTTCAACAAAGGCACTCCAACTCTGACAAAGTGCCTGCCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATG
GAAGAGCCCGATGTAGTAGTCGCACCTCTGATCCGTCATCGGATCAAAGTGTAATCGCTTCGCGACGTCATCGTCAACGATGGCGTTGCACGAGTACAGC
GCGTACAGATTCGGTGGCGCAGTCGCACCGAATCGGCTGCCGATCTCAGACTGAGACGGCATCCACGGCTCGCGCACTGGCTCAGTGTGCGAGGCCGCAA
CAACAGCGGATGGAGCGGAGTCATCTCCATCCCGCGGAGTCATCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAACGCTTCGAGCT
CGAAGCGTTCGGGTCGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCAGTGTGGCCCGGAGACAAGGTGTCCTTGTCTCCTTCGAGTTCCCCTTCC
TCGACTTCGCTTCCGTAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATGCCCACTCCGGTTTCGACAGAAATGATCTTGCCTGTCTTGTTTCGGA
TGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTGTTGCCGCGCTTGTCGACATCGCCATCGAGGCGATGTCATGGCT
GAGGCAGCGGCCGTCGTCGCCATGGAGGCGACGACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTGGACGAAGACGTCGTTGGCGTGCTCATTGGGA
ATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCACGTCAATCCCTAACGGGGGGATGGTGTAGCGGGGCTACACAGTCGGCT
CACCTCCTACCTTAGTGCAACATGCACTAATGCATACATTCAGGTTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAA
AGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAA
ACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTTGTTCATTTATCTAGGTTTAAGTATACTTGTTGATACAAGTATACTGAAC
TTAAGT