Description :
From Genome Similarity Track
Location :
scaffold_86:890- 3314
Transcript NameFunction/comments
g3128.t1 peptidyl-tRNA hydrolase, putative
g3129.t1 calcineurin-like phosphoesterase, putative

Sequence
2424 bases(100 bases per row)
TTGTTGGTTATCATGGAGGACTTGGCCTGGAAGTGTACAGCCGCCTTCGTGCTGGGCGCTGCAACGCACTACTTCGTCTCCTCGTACCTACTGAATGACA
TCACCAAGCCCTCGAGCAGTAGCACCAAGGACACCAGCAGCGACGCGGAGCCTCGCTCAGCCGCCTCGTCCCGGTCCTCCTCCGGCTCCTCCGACGACTG
GGAGGGCGAGGACTCAGCCAGTTGGGTGCCCCACAAGATGGTTATGTGCGTGCGCACCGACTTGAAGATGGGTAAAGGCAAGATCGCGGCCCAGTGCTGC
CACGCGACGCTGGGCGCGTACAAGCGCGCGAGCAAGCGGACGCCGGACGCCGTTCGCGCGTGGGAGATGCTGGGCCAGGCCAAGGTCTGCCTGAAGGTGG
ATTCGGAGGAGGAAATGCTCGCTCTGGCGGAGAAGGCGGCCGAGCACGGACTTGTGAACTACGTTGTGGTACGTTGACAATTTGGAAATGTGGCTGGGAT
GATCTTAAACTGATGATTTCGTTGTTTTTTTGACAGATTGATGCCGGAAGGACGCAAATTGCGCCCGAGAGCAAGACGGTGCTGAGTATTGGACCGGCGC
CACTGAAGGCGATCGATGAGGTCACAGGCCACCTTAAGCTCATGTGAGCGCGCTGGGATTAAACTGGGAAACAGTATCTTTGATTGAGTGGTTCCACGAT
CTTTACATGTGTACAGTATGCCATGCTTTCATTCCTGTGTGATGACAGGGTCAAAAGATGCTGCAGCTACAGCGTCGCGATGGTGTCGTACTGCGAGCGG
TTTTTCAGGACACCAGCCCGTTGAAGGATGAACACGGTCAATGCAACGCACGCCACTGCAACGACAGTCGCTAGCGCTGTCGCTTCGATCGTTGTCAACA
CGTCTTTTGTTGCAAAATTGGTGTCTGAGGCGCTGGAGCTGGACGAGGCCACTGCAACCACGTCAACCACGTGGCCAGCAATCATCGTTTCTGCAGTGTC
GACACAAGCCAGGTGCTCGCCCTTCGTAGTCCACCACTTGAGCGTACACAAAGTCTTGGCATGACAGGCTGCGTCCTTGCAAGGGCGAGCGTTGGGCGAA
CGGGCCTTCATGTTCAAGTAGTAGTCTTCCACTAAGCTCACGTTCTGCTCAGCGCGCTGCACAAAAGCCGAAAGTTCGGACAGCGATAGCGACTGGAGGT
CATAGGCCTCGCTTGCCCTAAACAGAAGCTTCCAGTCGAGTTGAGGGTCACTCTCCGTGATGTAGGAAGCATACACGGCATAGTCGAGCACCTCGTACGT
CTCAGTATCGTACTCCCAGACCATGAATGAAGGATTGTTGCCGAAAAGTGGCGAGATCGAACCCGTAATGTACAACGGCAGAAGCTGGAAAGGGTCGTCC
TCCCCTGTAGGCCCATCCAGCGACGTCACGGGTACACGGAACTCGACACTGTGCACATGGCCAAAGAACTGTGCCTTGATCACATCGGCATACTTCCCGA
CGATGTTCTTGTACTTCACGATGTACTTCGTGTGCCACTGCGGGTTGCCTCCGTATGAGTCCACAATAGGAGCGATATGACCAGCAATGTACGCGAATTT
GCCGGCGTCCTGCAGCTCCGCAAGAGTCTTATCCAACCATGCAAACTGGCCAAACGGATCTGGTTGCTTGGACGTGTCAGGCACATGACTCGGCTGCACA
TCAGACAGAAAATTTGTCAGCACTTCACACACCACTAGCATGCGTTTTAATTTACCGAGTAGGGCACTGTATTCAGCGTGATGACGTGCAATCTGTCGTC
CAGTGCATAGCTCAGAAATCCACGTCGATTCAGCAGATCCAGGTTCGCTGCTGACAACGAGTCTTCCCACACCTCGGAGATGATCTCAATGGACGGGTTC
GTCTCCGTATCCGGGTCCGTCAACAGCATGTGATAATCCGGGTCTGTCATAAGGAGCAATGGCACACATTAGCCTCCCTCCTTATATACGAATAACCTCT
GGCTGCTTCCTTACTCCCGTCTGCGTTGCCAATGACGGCCGTGACTTCCAGTTTTCCGTCTTGGCGTTTTGGCGGGTAATAATTCTCCATCACATGGACG
TTTGTCTCCACGGCTTTCGCAATATATTCATCAGTGAATAGCCCGTGCGCCGCGTGGTCCCCTGTGTACAAGAAGAGCTCAGGGTCGGCCACCACGTGCT
CTTTGGCGTATACCAGCGCAGACTCGAGAAGTGCCAACGGAGCGTCTTGGAAGTAACAGATGGGGATGCGAGCGTCGTCCGCAGCGGAGAACGACTCCGA
GATGTTCAAGTGCACGTCCGAGAAGTGCAGGATGCGCCCCACAGATGCTGCAGACGCCGGCGCACACAGCAGCGCAAGCAGCGCCAGTCCCAGCATAATG
CTTTGTGCTGCAGAAATTGTTAAA