Description :
From Genome Similarity Track
Location :
Scaffold_414:890- 3263
Transcript NameFunction/comments
Phyra_86007Amino Acid/Auxin Permease (AAAP) Family

Sequence
2373 bases(100 bases per row)
TGCTTCATGCACCGGAATCCCGCGGCACCTTGCAAGCTGCTCCCCTGCAAGGAGGGATGGGGCGACGGCCAGCAGCGCTCCGTCTCGGTTGACGAGTGGC
TGCGCGGCCACATCGGTGCTGCGCATCCTTCCTGCTTCAGATACTACTAACATGCGAGGCGGCAAGCCCATCCGGCAGCGTTGACAGCGCCCTTGGCACA
GTGCGGAGGCAGCACCTTGCAGCGCGAGGTCAACCTTTCGTACATGTACCTGTAGAAGTGGAAGTGGACTCGACGGCGGGACTTCGCTCGAGGGGTTCTT
CAGTGCAGACAGCAGCGGCGTAGGCGCCCGTGCTCTGCCTTCATGTGGCGCTCCGTATCTTCATCAGCAAGTCTCTGATGCAACGACAACTTGCTGCAAC
TCACATGGTGCGAGCAGGGACATGAGCTCACAAAGCCCAACCTTGTCTAATCGCTTTCCCTGATGCAGCCAAATTGGCCAGAGCACTTGCACCGATGTCA
CGGCTGCTTTGCACGGACACTTGGACCCAGTATGGTTGCCAGCTAAAAGAGCCGCCAAGCTCTTCTAGCGCCCCAGCGCTTGGAGCTTGCTCACGCACAC
AGGAGACAGGCCAAGATGTAGCGCCGGACACCAGAAGAGAGGAGCTTGACAGAGTCTCTCGCGAGCTGCTGCTTTGGCTAGCTCACTTTGGAATTTACCT
TCTCCTATAGAAGTCCAGCCTCGCATCGTCTTCCTTCGCCTCGACCGTTCCACGATGTCGCCCGCCAACGGCAAGACTGCCTTCTTCACGATGGAGGACG
CCAAGGCGTCCTTCAACCTCTTCTGCTGCGTGTGCGGTATCGGTTCGCTGGCCATGCCTTCCAACTACGCTCGCGCCGGCCCGTTGTTTGCGTCCATCGC
GTTGGCCTTCATGATCTTCGCCAACACGTATGCCACGCTCAAGCTCTCAAGAGTAATGCTGGCGGCGCCGTCGTCCGTCAAGACGTACGGTGACCTGGGA
GAGTGGGCCCTGGGCAAGTGGGGGCGCTTCTTCACGGTCGTCTCTCAGATGGGAGTGTGTCTGCTGGTGCCGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAGGAGAGCGCCGGCATGGCGTTCGCCGGCTGCATGGGCACGGTCGTTGCCGATATCATTGCTGTGATTGTGCTGCA
GTGGAACATGCGCGGCCACGACTCGATCCCGTCGCCCGACATTTCGGCTCACCAGGTGCTGACGTGCTTCGGCAACCTTGCTCTGGCGTACGGCGCTGCC
ATTGTGGTGCCCGACCTGCAGCGCGAGCACTCACAGCCGCAGCGGATGCCCCGCGTGGTGGTGATCACGATCATGTTCATCTCGGGTTTTTTCCTCGTGG
TCGCGCTGGCTGGTTACACTGCCGGCGGCTGCCAGCTTTCGGGCAACATCCTGTACTCGATCGTGAACACGTCAGACCCGCTTGGCCTGGCGCCTCTGGG
CTTCACTGCCGACCGCGGTGCCGTGGTGATGGCGTACCTGTTCATGCAGATGCACATTTCGATCGCTTTCTCGACGCTCATGATGCCGCCGTTCTACATG
GCGGAGCGTCTTGTGCTGGGTATGCACAAGGGCCCCGAGATCGTGCGCTTCAACGGTGAGGCGGACCAGGCGAACGTGGACCTTGACCTGGAGATCCAGG
ACAAGCGCTCGTACATCCAGAGCTCGACGCCCGTGGACACGGCCAACCGCCAGGTGTCTGCTTCGAGCATGGTCGAGAAGTCGGAGGGCCGTATGTCGCA
CCTGCGCGTGGCGCTTGAGTTCGGCGAGGAGATCACGGAGCAGCAGCTGCACGAGCCGTACCGCAACAACCCGCTGCGCTACATCGCTCTGCGCATTTGC
ATCATTGCGATTCTGGTGGTGATCGCCGTGCTGGCGCGTAAGCGTTTCATCGACCTGCAGGACTTCACGGGCGCCACTGCCCACACGACAAGCTGCCTGC
TCATGCCGCTCATCATCTACCTGCGCGTGTCCTGGAAGAGCATGTCGATTGTGGACAAGGGTGCTTCGATGCTGGTGATCGTGGTGTGCGCCTTCACCGG
TTTCTACGTGATGATCCACGCCGGCGAGCACCTGTTCGCGCCGACGGACGATGACACGCTGTTCCCGTACTGCGAGGCGGAGTTCCAGGACGCGCCGTAC
TATATCCGCAACAACAGCACCAACTAAGCCAAGCCGCAGCAGCCGAGAAGGCAGCGCAGCTTGGTAGCGGTGATATATCATAGTTTTGTGGCTGGGATAG
AGGTTGTATATCCGTGTCCGACAAGTTTTAAAGAGCAGCAGCAAATACAGTTTCTCGTGTTGTACCCGACGTT