Description :
From Genome Similarity Track
Location :
Scaffold_2072:890- 3015
Sequence
2125 bases(100 bases per row)
ccgCTACTGGCTGTGACGTTGTTGTTCCGCTGGAAGCCAGTCTTTGACACACTCCCGCACGTTGTCAACTCTGTATCGATCTTCCTAGACTCTTCACTGG
AGCTCCCTCTGACGCTTTTGAACCGAATTTGGGATAGTCGAGCCGATCTGGAGCAAGATACAGCTACTTTGTGGTCCGTTCGATGTCTATTGAGGACGGA
AGACTACTATCGAAAATCTCAGTTTACGAAGTCTCTACTGGAGGCGGTGCAACTCAAAGATCTGCTAATCGCTCGGTGGCTGTTTGATCGTTTTCCTGGG
TGTTATGTTGGGGGTAAAAGTGGTAGAAaaggctgcggctgcgggGGCATTGGAGATATTAAAATATTTTCTCGAGAATGATGCTGGTTttcacgaagaa
gaaggaacgGATAATGACGACAGTGACGGAGAAAATGGCGACAATTTGGACGATGAAAACAGTGGTCAAGAAGAGGAATACAAAGAGGAGCACGGTATTG
AAGTGGGAGGCGAAACTAGTGATAACCAACCacggagaaggtggtgattTAGTCTACAAAGATGAGATAAAGCGATGCTATGTTGCTTGGGGTGACGAGG
ACGCTGCGAAAGCTATAGATTCTGGGCACAAGGAGGTGGCAATGTGGCTGTATGAAGATATTCCAACCGCAGAAAGAAATGATGCCATGACCAAACTAGC
TGCTGTAGCTAGCGGAGACGTGGCTTTGGTGCGATGGCTGACGGAAAGGATGGACTTTAGCCGGTATCATCCAGGCGCCattcaagctgctgaaaatggA
CACGTTGAAATGCTTCAATGGATTTACGAACAGAATAAAACCATGGATGACGCTGGATTGCTAATAACAGCAGGAGAATGGGGTCATATGAATGTGGTTC
GCTGATTGCTGGATCGACACTGGGATGATGAAGACTTGAGGActgacagcagcagtggctaTGACAGCGACAATTATGAAGCTCACTCGATCCGTAATCG
TGGGAAACGTAAACGCCGAACTTGCCTTACGAATTTGGGTGGGGAAGCCAGCCTTGCTGTTCACGGAGCTGCGACTGCCGGACACTTAGACATCGCCAAG
TACATCTATGCTCGCATTGATATCGCGATGAGTGATACGGAGAGGCTGAGCGAGGGGTGGAGGCTGAAAAAGATGTATAAAGCTCTGCGGAGTGACTTTG
GTGGCTATCGTATCGACGCAGCAAGAATTTCGGGTGAAACCATCGTTATGGCGACACAAAACGGCTACCTGGatgtggtgcagtggctgtaCACCGAGTT
TAGAATCGAGCCCACCATCAACCTTTTCTGGTACTATGACCACAAGCAAAAGAAGACCCCAAGCGCTATCgatgcagcggcagcaaatGGCTACTTGGAG
ATACTAATTTACCTCCATGAAGTTGGGGGTATGGCAGCAAATATTACGAAGCAAGATCCGAGACGGAAACACAGAAGCCAATTTTTCGGTTTGTGTCGGA
TTCCCCATGTACCAGCATGTCTAGTTCAGCCAGAAGACCTGCCCAAGCCTGGGTGCACAACCTTAGCTATGAACGCGGCAGCCGGCTTTGGTTACTTAGA
TGTAGTGCGTTGGCTCCACAATAACAGGACGGAAGGCTGTACGACTGACGCAATGGACTTTGCGGCTCAGATGGACCACTTGGAAGTTGTTCAGTGGCTA
CGTCACAACCGCACCGAAGGGTGTACAACTAATGCACTTGACAATGCGGCGAGTTGTGGCCATCTTCTCGTAGTGAAGTGGTTACATCAGTACAGAAGCG
AGGGGTGTACCATTAAAGCaatggatggagctgccagCGGAGGGCACATGCATGTTGTtcagtggctgcagcaaaataGAACAGAAGGCTGTTCCAGTGC
AGCGACGGACGGTGCGGCGGCTTGTGGAGCGCTAGATGTTCTGAAGTGGCTTCACCAGCATCGGTCTGAGGGTTGTACGACGGCAGCAATTGCCAAGGCA
GCTAGAAATGGTTACTGGCGTGTCATTCTATGGCTTCAAGAAAATGGACGGGAAAAATGTACGACTGCAGCTATGGATAAGGCGGCCAAGGCTGGCCACT
TTGAAGCTCTTATATTTTTGCACAG