Description :
From Genome Similarity Track
Location :
Scaffold_122:890- 2861
Sequence
1971 bases(100 bases per row)
GTGACGCGGAATTGAAATCTGCCGCAAGACCAAGTTAAATCCATCGACTTCTTGAGGGTCGCCTCAAGGCGAGTCATGTGCGCGAGAGCAGATTTCCACA
TTCGAGTCAGATATCCTGTGTTTAGAAGACCACCAACGGATGGCGTATCGTAGAAAATTTGAATGAGACCACCATACTGGCGCAGGCGTCGATCCTCCGA
AAAGACATGATATTGAGCTCCATGTTGGGAAGCGTCATCTATAGTGCCATCGAATTGACCGATTCCTTCTATCGGAGACCGATGAGACCAAGTGACATGC
CCCTCACAACAGTGAGCTCTCCAAGTGATATGCTTCTGTGAATGGCTGGTGATGCCACAAGGTGTAAAGAACGCTCCTGCAACGTTTAACCGCATGGTTT
CCCATGTGATGCGACCGCTCCGCATATTATCGTCAGTCTATTAAGATGATATATTCATTCAAAGTCGCGCTGAGGGTGACCTCAGCGCTGTTGGCGTCCA
TCTCAACCATTTGAAACTAGTTTCCCAAGTCATGCGGTAAAACAAGCTATACGCGAACCTGAAGAACTATGTTTTTTGCGCTCAGGAGATTTCGGTTCTA
AGGTGCAATGTAGAGAAAGAAGGAGAACGGGATGAACCGAAGAAAGTTTCATCCTTTTAATCTGAGCCCATTCCAAAGAAACCCGATATGTTGCGTCAGT
AGCGTGGATTGCGGAATTACTTGCATAAGTATATCGAGGATTGCGGGACCGATACAACCACTATCTTTACTTGTCAAGAAATACGCCACAGCCACGTGGC
GTCCTGAACATCAAGTCGCCTTCTGTTCCGTGATGAAGAGTGTGGATTCGGCTCCAGTCTTGGTCCTGCATGACGATTCGAAGACGTTTCACGTCTTGGG
CGATGCCATCGATTTCTCAATCGGCTGCGCACTCATACAGTTTGACGACGATGGCCGCGAACGAGTCGTGAGCTATCAGTCACGACAACTGACGAATGAC
GATAAAATTATTTCGTTCACGACAAGAAGCTGCTGACGATGCTTACTAATCATCAGGTTTGTTTACTTTGTTGCCGAGCATTCGCGTTGTACTCTGATCA
TAGTTCATTGCGCACCGCAATGAATATCTGCATTTGACTCAGTGCATGGCACGTGAATTTTTTTTCTTTTGTAGTACGACTTTGTCGTACATTACTAGAC
GGGCAGAGTAATATTAGTGCCGACAAACTTTCGAGACCTCCTGATTGTGATCCACGTCATATGCCTGATCGTCAGTGCTCTGGACGAAGAGTATGACAAC
TATGCGACTTGTGTGGCGTATGAATTTGACAAGATTTATTACCGAGTTGCATCTTTAAGATACAATCGTGGCAGCGTATGCGGGTGATCCTAACTGTGCC
AATGTAATGAAGAACTTTCGCTCCCCAAATGACGCTTCATGCTCTCTCTCGTACCAAGCGTGATCACATCACGCGATACAGTTCCAATGTAGATCTGTTC
ATGTACAATATATATCGCATCGATGCTCCGCGTACAGTGTTAACTGATGATTCAGACCTACGAGCTCGGATAATTCACGAATTTCACGACGCCCCAGCCG
GTGGTCATCTCGGTTGCAAAAAGCCTTTCACGCTGTGTCTCGTGATTTATATTGACTCCGCTTTTACGTGGATTCGTAGATGGGTTCTTACGTATGAGAC
CTGTCAGCGAGGAAATGACATCTCCTTCGTCACAGGCTCCTGTGCGACTGCTTCCCATAGAAGCTAATGAATGGCTTTCGATACTAACAGATTTCATCCT
AAGTACTCCCGATAGTTAAGGTTGCACTGGTACCCTGGGTTTTCGTCGATCGGTTCAGCGGAATATGAATCCCCTCACCCTTGTTCTGACATATTCACCT
CAACCTGAGACCGCGTCGCACTTCATCACCGTCGTACATCGTCATCTCGGTCTTACGGAGTCTATTGTCTC