Description :
From Genome Similarity Track
Location :
Scaffold_3479:890- 2531
Sequence
1641 bases(100 bases per row)
GCATACAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGTAAGAAGGGCATGCAGTCGTTT
CTTGGAGCGGTTAACTACTACAGCCGCTTCATTCAAGACTTCGCGGTCTACGGTGCGGCGCTGTACCAGCTTAAGGATGAAGACTTTGCCGTTGAAGGTG
GCCTTTCTGTGGCACGTCGTTCCTTCAAAAAATTGAAGGCGAGTGATTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGCAGTTCACGTCAT
GCTCTTTGCGAATGAATGAACGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGCTCCTCGGTCGGGTGCTTAAGGAAGCC
GAGATGAACTACCATCCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGATGCTACATGTCTATA
CACGATTCTCGACGTTAGAGTGGGTGCACAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTCGCAGTGCTGCTATCGCAGTGGCACCTTAAGGTGCA
GCGCGTAAAGGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTTGACCTGGAGGACTCGCTCGCGCCGGTGGCACCTCCA
AACAAGGGTTCCCCGACTGTTCGAATGGACCCCGCGTTGCTGTACGCCAGGCTTTCCCGTAATTACAGCGGATTCGTCATAGCTTTTGATGGATCAGCGA
AGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGCGTGGAAGGTAGTAATTGCTGCAAATGCTTACCTCTCGGCTAC
AACGGTGAATGAGGCAGAGTATACAGGTATAATAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGGGACTCAAGGCTC
GCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAGCTCACGGCCAAGCTTCGATCAGTTA
AATATCCTCACGTTGTACGAGAATACAACGCTGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCAAAAGTCAGTCGGGTCATCTTGGCTGAAAATCG
CAAGTCGGAATTGGCGTCGCTGAATCGCATCCAGGAAATGATCTACGAACCGGATGAAGACTCGGTAGATGTTTCGTCACGTGGAGCAGAGCGTCAAGTA
CATGTATTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAGAGTGCGATTATGGTAATATGGCAGTGA
TGACTCGGCGACAGACGAAAGCCAAGATCATGAAATCCCAGCACGGACCCTGCGCTGTAGACCATGACCATTCCTATCGCCAGCAGGCTCAAAATGCTGA
TCAGGAGCCAAAGGTCCGGCGCTCGGCGCAACTTGCTCATAAGCGGAAGCCACCTCATATGCAGAAGTAGGGGCTTGTCAGACACCCCCCTACTTAAAGG
GTATGCACCGCCTCTTTAAAAATGCGTCCACGCTCTCATAG