Description :
From Genome Similarity Track
Location :
Scaffold_1159:89- 7734
Transcript NameFunction/comments
Phypl_g12602hypothetical protein
Phypl_g12603hypothetical protein

Sequence
7645 bases(100 bases per row)
GCGCCCTGGGTCACTTCGAGTGGCTGTGAATGCCTTTCGGGTTGAAGAATGCGCCGGTGATATATCAAAGACTCATTGATAATGCAATCTGGGGATATGT
GCAGCTTAAGGGTGGCTGGACGTCGTTCGCCGAGAAGGTGCGGCGAGCcgagaaggctgcagcagctcagcgatCAGCCCAACCCGCTCAACTGGCTCGG
TCCGACGACTCAGCGAACCCCGTGACAAAGTTCGATGCTGATTGTCGTGCCCTCGACGAGTCAGACccgctccaggagctcatcAACAGCCCGGATAGTG
ATATGTTCAGTTCAGGAGAACACGACGAGTCGAAGCTAATCCCTGTCTTTGGACGTAGATCGTTTGTCGATAATATTCGCTTCGGCGGGGAGAGTTTCGA
CGAGTGTCTGGCAACGTTGGACCGACTGCTCACCCGATTCGCTGAGTGCAGGATCAGTGTGAGCTTTGGCAAGAGCATTTTCGTCCAGCCACAAGTCGAC
TTTTTATCGCATAAAGTCACAGCGCAAGGTATTGCAGCTGACCCCAAGAAACTGGTGGCCATCGCAGAATCACCATTTCCGAAGTCGAAGAAGGGCATGC
AAGCATTCCTTGGAGCCCTGAACTACTACAGCCGATTCATTCAGAACTTGGCTTTGTATGGGGCTGTCCTCTATCAACTCAAGGAAGACAACTTCACGGA
CGGGGGTGACCTGACTGCCGCCCGTGCTTCGTTCGACGAGTTGAAGCGTAAAGTGATTGAAGCTCCGATACTACGACACTTTGACTCAGCGAAGGAGGTC
CATGTCATGGTATTTGCCAATGACTGGGCGCTCAGCAGTACCATGATGCAGATgcacgacgacaagctgcaccCAGTCCGCTTCTGTGGTCGCGTCCTCA
CCCGCTTCATCAAGGTGACACGCTGCTTGATGCAGTTGATCCTGAGTTCGCCGCAGCGAGGTGATCGAGCTCGCGATCACTCGATTGCCGAGGCTTTGTC
AATCGGGGaccttgccgtcgctgttggTCGACCCGTCGAAGATCCCCGCGACCTTGCTCAAGGACTCGGTCGACTGCAATCCCAACTCGAAAAATAGCTG
AGGCTGCTCGGAAGCACCCGAGAGACACGCGCTGAgaacgacgagctgaagcgagCACTCGAGGCTTCTGAAACTGCGCGAATCACGGGCGACAACCAGC
TCATGCAGATGCAAGCGTACGTGGATACTCAGGGTGAAGTCACGGCCAAGATTACTGCTCGTCTCAAGGCTGCCGACGTTTCCCGTGATTCTCTTGCGGC
CCAGATCAAGCGTGACTGGCAGCTCTACAAGAGGGATTGGCATCCAGCGCGAAGCGTGTCGGCATCCTCCAACGATACCTCGCTGACAAGGGCGACGCTA
CTGCTGACCGGGCTCAACGTGGATTGCTCCGGGACATGATGTTCACCGTGGAGAAGACACTTCGAGCCAACCGGTATTTGCGGCAGTTTGTGGACGATCG
TGACTTAGATGCTGACACGCTGTTACTTCTTTCCAGAGGTAGGTGCCACTTTGCGATTGCTTGCCCCCTTTGGCGGAGCGAAGTCTCATCACATTGTGTT
GTCATGTTGCAGGTGGCTGCGTCGGAGAACTCGACGTCGGTTTGTTGGGTCTAGATCCAGTCGCTACTGAGATCGTACAAGACTTGGTCCGAGAGATCAG
CCCGACTATGTCGGCCAAGGCTCAGGCGCTTGAGCTGGCTCGCCAAGTGCATCACCTGCGAGACACTTTATCTGTCGGTGAGCTCTCGGATTCCACCAGT
CATCCAGATACAACTGGAGATGTGGATCTGGGACTCGGTACGGATAACGAAGGTGGTTCTGGTGGCCACAGTGATCCGACGACTTCCACCTCGTCACCGA
TGTTTCGCGTctcgtcttcgccatccCTTGGGAAGCGATCCAGAGTGATAGCAGATCAATCGTGTAATTCACGCAAGGTCAAGAAAGTTCGCCCGGACCA
TGGTTCCAGCAAGAGCCCGGCTCCTATCTCTCACTCCCCACGGAAAGCTCGCTTGCAGTCCTCGAGAAGAGTTCAGTCGCTATCCAAATCACtgtccaag
cccaagcctGTGGCGTTGCCTACACCCGTGAAGGTGTCGACTCCTCGTTCACGGCTTCTTTCTCCAGTTGCCTCCGTTACGTTGTGTCCTTCGAAACCTG
TGCCTGATGCCCCGACGCTGGATttggcgtcgccagcagGTGACCAAGCTACACGCTCCGACTCCGGAGCACTTTCGAactcctcttcttctggaACGTT
GAGTCGATCCAAGCGTTCGGCCGCTGTTCGTGCTCGTGATACCTCGGCACGTGTACTCGCTGAGGAGGCGGTGAGCAGCGAATTTCTCCTTGGGTCATGT
TCGCCGGCTTCTGAATCTCGGCAACCGAGCCCTCCTCGCTCTCCCGAAGCTCTGAAAGAGGAAAAGGATAACGGTATGCTGACTGCGACAGAGATGGTGG
GGCTTGAACGGGAGTTGCAGGCTCAACGTGTGAGCGCTGCAGTGAAGCCTCGGTCGCGTCACATCTCGGTTCCAATGCCCGCATTGGCTCCCCGGTAGAC
AGTGTCAATTCGTGAAGCCGTACCGCCGCACACCGTGGTCCTGTCACGATTGAAGTCTGCGCTCGGATCCGACCCAGAGAAAGTCGAGCTGCCAAAGCGG
CTTCCCGCTAAGATTCGCGGATGGCAGCCGTTGGTGAAGCCATCGTCCAAGACATTGGAGATAGCGACCCCGTTCGTGGAGCCAGGTTTTCGTACCAGGA
CTGCGCAGATATGCTGGCTTCAGATCCTTAACTTCCGTACACCCTTGCCCATTCCTGTAAATCTCGCCACCGAGGTTTCTCTTGAAGGGATCAAGGCTTT
TGCGGACTGGAAGAATCCCGATCATCCATACCAAGTTTTCATCAAGAAGTTTCCCCGCCACGCGTGTTTGTTCGACGTCGAACCATTTCTCCCGGACGTC
CACATCCCAATTCGCGCTTCCAAGACTGCACACACCGTCAAGATCTGGCGTCAAGCTCGTGGTGAGAAACACGAAGAGTCGGAGAGCAATGAAGTTGGGG
TTGCTCTGTGGGAGTGTGGCCACTGGATGTTGAAGTCCGTCATTGAGAcagcgctgaagaagctggtggcaAAACTCGGTGAGAATTCACCTCTCCTCGA
GGCTATCCGTGCCGTCTGTTATGGCAATCTATTGAGGGTAACtggtttgatagcggttcttaaccgtgaaccaGTTAGCCCGAACCAACCCACGTTGATT
ACGCTCCATCGATTACGCCACTCGTGGGTACAAGATTGTGGGTACATGATGGGCATCGACGTGGCGCTCTCTGATTGNTCAATCAATCACTTTCGAATCT
TCCTTCTACCCCTCAAGTGGTTaagtgtcctcgctccggtcaagcccagcgtgctcactccctccgcttcgtccaagcttcgtgtccaagatccatacct
tccatcacTATCTCAAGGATCGTAACAAGCGCGCGGACAACCTCCGCAACAAGATCATGCAGTTGTGGCAGTGGTGTCTTCCGGACAAAAAGAAGACCAG
CGAATTGCCGGCTGAGTTCCTGTTCAAGCCTTCGATGCCCCTGTATTCGTTCGAGGTGCTACCATGGGTCCCTGCTActgtggcggagcaggaatCGCGA
AATTGCTAACGCGATCCAAGCTAGCCAACGGTTGCCCAGACTACCAACttacggagggggtactccgttCGTCCGTGGGGGCTGAAGtcttctcaccttg
tgtacccgttggttgggcgggttacgctcttccggtgacggcgaagaagTCTGTGCGATCTTGAGTTGAGCTTGTGTGGACGGTACTTGGAGGATTGTTG
GTGACAGccgcgtggaaatcttcactTGGCCGTCGAGTGGAGCCGATCAGGGTCTTGGATGTGCCTTGATCAACTTGTGGGGGTGTCGTTGGGGGTTCCT
TTCCGTGTTTGCCGCTTCCTGTTGGCGGGATCTTTGAGTggagagaaggtggcggcctgGCCAAGCGATCCAGGtgtcttcggcgtcttccCTGTGCGNA
CTGGCTCCCAACTCAGATTGGGTGCTGATGTACCCTAAAATTGGTACCATGTCGATCTTGATCGGGGTGTGCTCAAATGATTGCCCCATATCACCTTATC
CGCTCAGCTGCGCAAGCGCTCCACCACAATCGCACCCTGTACGAGGACCTGCTTCACAACAGTCGGTCCACGCACACTCACGCGTCGTCCCTCCAGTTGT
AACCCCGACTTGATCGGTCTCGCCCAGGAATGACTGCGGGCAATCTGGAGCCATTCAGTGTACCCATTCCATGCGGGCGACTAATCGTCCCCCTTAAGTG
CGAGCATGCCATGCGGGTAACAAATCGCGCCTCTTAAATCCGAGAAATGCCCTGATTGGCCAGGACTGACTCGTTCTCACACTCTCACCCGCAAGCGATT
CTCCAGAACCGCCATTTCCGCGAGAGGCGGCCGGACAGCGCTCGAACCTGGCGCACCCCTTTGATtccgcttcgtcgccgtGACTCCAAGCTTGTTCGCG
CCCACATCAGGCCCCTCCAGAGCTTCCCTGACGCCTCCAGGTACGTTCCCCAGCGAAATTGGTCGTCTTCTACGGTGGTGACGTCCACTTGTCGCTGATC
GGCCCACTGACCGAGCTCGTGTGTGGTCTGTGCAGGATGGACATGTTCTCAGGATGTCCTGGGTCATCGCCAGCTTGTGTTGTCGCCCGCCCCACTTTCG
GTGACCACTGCATCGACCCCGGCAGAGACGGCTCGCTAGTGGGCCCCGGTTCCAGATCAAGCAAGGTACGAGATCGCATTATCCCCTTCTTGTATGTTGT
AAGGCTGAAAGTTCTCCGTCGTGACGATGCGATCGCTTGTCAGGTCTTGCTGCTTGAAATCGATCGAATAGCCGTACCAGATCACAGTGGATCGTGTTGG
TCGGACCGGACAGCGATGCAACCGTTCCCAACGCATATCAATCACGAGCCATCGCACCAGTGCTGGGAACATGTCGGCATGCACTAGATGCAACCCAACG
CCAACTTCTGATCGCAGTATCGAGTATGCATCCACCCGTTTCAATCAACTTGATCGACCTCAAGTTCAGATCGATCGGTAACTTGCGTGTCGCCATCACG
AAGTCCAACAAGTTGTACCCGATCATAActgctccaccgcctcgcgCGACATAAAGGCAAATTCCAGACCGTCACGAACAGCGACTGAAGATCTACCGTG
AGATGGGTGTGGCCCTCCAAGATAAGAGCTCGGGTAACCAACGTCGATATCTATTTTCTTCTTGCATGGAGTCCGTCTAGACTCGGATCAGCATGGTCGA
TCCACCTGATCCTGAACTCACAATTCACAAATAACCCTTCCTCCTAGCGTGCGGCCACCCCGCACACTCATCACTCACTCATTCCCCcttcgcagcagcc
aacCTACTGCGAAGAGTCGCCCATGTCCCCTTCATAGGACTACATCACGTCAAACCGGTTTCGGCTCACGCGATCCCGCTCGAACTCGCGAAGCAGAGCG
CCACAGTTCAAGGCGGCCTCATCCACCCACGTCGGCTCGTCGTACCCCTTCCAGTACACTTGGAACTCTTGATGTACTCGCCCGTACCGCGTCCTCCGCT
CCAATCGTACGTCCACGATCCGCTCGACTTCAAACTCGTTTGCATCTAACGCTCTTTCCCAGCTGTCTTCTGGCAGGAGCGCCTCATTAAAGTCGACGCG
CTCAGACTTGCCTACAGCGAGCGACACGACTGGCCGATCTGGAAACTCCtgaccagcttcagcttggacacGTGCACCGTCGGAAAGACCCGGTACTCGG
CACCTGCGATCTCCAACCGGGCAGCATACCGATCCACCATCTCTGCTACGCGAAACGGCCCATGCCACATGTgtgccagcttcttcgcgtagCCTTCCTT
CACTCGGTCCAAGAACAGCCACACCTGTGACCCTGCCTCAACCCCGTGCGGCTGGAACTCCGAATTGTGTTGGTCGGCCCGGTCTTGGATCGCTTCTCGA
AGACGCTCGTTGACCTGCTCACGAGCTCGCTGGTACTGCACCTGGATGTGGTACCGCCATCGGTGCGGATCTGGATTGCGGCGACGCGTGCTGCCTAGCG
GCAGGGACGCCTCCAGTGTCGACGTCGGGTCCCAACAATGGACCAAGTAGAACGGGGTGTCGCCACGAACTCGATCCTGAGCGGTATCCAGCGCGAACGT
GAGACGCTCCGCATACTCGTCCCAGTCCTTCTGGTTGACATCCGCCACATATATGTTGAGCGCTCGCGTCAGTGTCTGCACCATGCGTTCCGTCGTACCG
TTGGCCTGTGGTCGgtacgccatcgtcgccctCTGCCTCTGGCCCACTATACGGTTGAAAGCCCGGAAACACTCTGACATAAAACCGGGTTCACGATCAT
GCCGGATTGCCTCACTCGCTCCAAAGCGCCGAAACACGCACTCCTCGTAGTTTTCCGCGATCGTCTGCGCAGTgcgcgaagcgctcgccTTCGCGATCAC
GTATCCAGTGAACAAGTCGACCCAGATCAAGAGCTCGGTGTTCCCCTTGAACGACTTGGGTAGCGACGGGATGTGGTCCATCGCGACTATCTAAAACGGG
TACGTGGCTCGCATGTTCCCCGGCGATTCCCCCCGGATAAGTGGTCGCCCCTTCCCAGTCTCACAATCAACGCATTCTCCCAGAAACCGTTGGACACTCC
GATATAGACCTCTCCAGTGGAAGTGCTTCCTGATCGTCTGGTACGTCCTCCCAATACCCTGGTGCCCGCCTTCCAACCTAGCATGGTAGTGATGGAGAAA
GTCTTGTTGCAACGTGTCAGGTACCACCAGCCGCGCGATCGAGTCTCGATCTTCATCAACTTGCTTGCCCACCGGACagaagaacagcagctcaTTCTCA
TCCAGATCGTAgtcgtccgcgagcttggcgcaGGACTTGGCTTCAGCGGTGCTAAGATTGACTACGTCCCCCCGAAGGTACGCCTTCAGATCTGCGATCC
ACTTCTCCTCGTTCTGAGCTTGAACAATACGCTCACTTCTCATGCGTTGCACGATTGGTTCTTGCAGGACTTCGAGCTGCGGaggtcttcttcttgccga
tCTAGTGAACGCAGTCACGCGGACGACTGCGTCAACCGTTTTTGGCTTCAGCAGCCCGTCCAGCCTGTTGAGTGTGATCAAGTCCTGACGATCTTCCTCC
GAGGTAAccactgcgtcttcttgaccTTGTAACGCGGTACTTGCTAGCCGATCGGCGCTCTGATTCCAGTCCCGCCTCATGTGCAAGAGCTCATGCTTCG
GCCACGATCTAAgtttctccagcgccttctgtCGGAGCAGTTGCAGACCGGGTGCCTTGCAGTCGATTTCTCCGCGCATCTGCCTGATCACCAAGTTGGA
GTCTCCACAAATGATCAGTCGCCCCCTGTCCAGATCGGACAGGAGATCGAAGCACAGTAGCAACCCTCGATATTCGGCTTCGTTGACCGTCAGGTCAGCC
GTATATTCCGACGCCGCGGCGAGGATCGTCCAGTCGGGGAGTTTC