Description :
From Genome Similarity Track
Location :
Scaffold_863:89- 1949
Sequence
1860 bases(100 bases per row)
AGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCCGACCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGGCAGTAC
TTCTTCAAGCTCGTCTGCGTCGAGAAGTCGTAGCAGAGTCAGCCTGTCGGCCAGATCCACGTCCCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGC
AGTACCTTGGATCCCCCATCCTTGATTTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGC
GAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCC
CAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTA
ACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGG
ACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCAGGGTCGAACTCATCATGGAAGTTGTCTGC
CTCCACTGACTCCATTTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTC
ATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGCGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTAC
CTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCG
AGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGATCCTCGCCTGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATTCGTCGTGGTTCGGAC
GACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGTGACGACACCGGATCCATAGTACGCGACCTTTCTC
CGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGGTCCAAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTAC
GATGCCTGACTCCGTAAGCAAACGTAATCGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATC
TGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTG
ACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGAGGTCTTACTCATCTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGG
GCTTGGGTTTAGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCG
TCAAGATTCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCTCGTCGACAGAGTTC
CTCCTCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCC