Description :
From Genome Similarity Track
Location :
Scaffold_6:89- 1906
Sequence
1817 bases(100 bases per row)
CATCGCTTCCCGATCCGCCGTCACTGTCGACTTGGATCGCGGATCCCGCAGTGCCGCCTCCGGATCCGGCTGTGCCAGCGACTTGTGGAGGCGGTGTCGA
GAGGGATCTCCGCCGGGCTTCGGATCGGGATTGGGACAGAGCCCGTCGCGTGTCTTCCTCCAAGGCATCCTCAGCGGCTCGAGCCTCCTCCGAATCCTCC
GGACGCTCATCGTCATCGTCCTCGTCCTCATCACTCAGCGTGAAGGGATACGGGCCGGAGGACGACGAACGCTTCGACGACGATCGGATGGGAGGCCCTG
AGCCGTCGGACAAGTCCGACTCCTCATCCTCGCCGTCCTCCGAGCTGCCAAGTCCACATCCCGGGGGAACGACACGTTTAGCTTTCCCCTTCCCGGGTCC
AGCACGGGCGGGCGGATGGCCGGTGGAAGCTGGCCGAAGGACGGCAGGCGTCGTCACCGAAGGGGCAGCGGTGGATCCCGACTGAGACTGTCCGGATTTA
GCCGTGGATGGGGCTAACCCCGTCGTAGGAGCAACGATGGCTGTGGATCCAGTGGACACCACTGCCTGGGACGACGGCGCAGTCGTGGATCCAGTTTTGG
GCGCCGATCCCGACTTGGATACAGCAACGGATCCAGCCTTGGCAGTTGATCCGGATTTGGATGCCGAAGATCCCGCTTTGGATGCAGCAACGGACCCAGT
CTTGGGTCCGGATCCGGTCTTGGACGCTGTAGATCCAGTCTTGGGCCCAGATCCAGTCGTGGATACTGAAGCCGACTTAGATGCGGTGGTGGATCCGGTC
TTGGATCCGGCTCCAGACTTCGAAGGAAGAGGCGGAAGTTTTGGACGTGGATGTGGGACCCGTCTTGGATGTGGAGCTGGATCCTGCCTTGGGAGCGGAT
GTGGGTCCCACCTGAGAGGCCGCATTAGAGGCCGAATCGGTTTTGGATTCGGCCTTTGGGGAAGCGCGGGCATGCTTGTGAGGACGGGAGGATCCGGTGC
TAGGAGAGGGAGATGCACTACGCGGACGTTTCGCAACTGACGGATCCGCCCCACTTTCAGACGGAAGAGGAGCAGAGACGCTGGCAGCACGAGGGGGTCC
CGACAAGGGAGGAAAGGGATCCGACACGGCAGCTGTCACCAGCGCCAGTCGTCGACGTGCCAAATCCCGCTCCGATAAGCCACGATCGCGCTCCAGGACC
AGCTGTTGCTGCTGAGCTTGGGCTGCAGCGAGTTGATCCCGAAGTTTTGCTGCGGTTGCCTCAGCATCCTTCAATTTGTCACCTGGATCGACAGAACAGG
TGAATATGGGGTTACTAGCGGGGAACAAAAGAGGATCCACGTACTCGTGCGGCGGAGCTTGGATTCCAGCTCCGTTTGCGTTCGCTTGGCATCCGCCCAC
TCGGTAGCCGCCTTGTCCCGCTGCAGTTCGCTGTCCGCCAGTTTCGCTTGGATCTCGTCGCGTAATTGAGTTATACGCACGAACTCCTCGAGCGCGTACT
CTCGTCCGGCAGACGCTTTCTCGAGCGACTCTTTGGTATCCTGCAACTCCTCAGCAAGCTGAGCCAGAGCTACATCCGGCGACGAGGGAGGTGGATTTGG
CGCGGGAGATCCTCCACGCGCCGACCCTAAGGTGGATCCGCCATGGGTGGATCTCACATAGTCGTTGGTCACCACCTCCTCTAGGGTCAGACGCAACTCG
TCACGGAGCCGGTCCAAGCTCGCATCCGCAGCTGCCCCAGCAGTCTGGAAATCCTCCAGATCCCGCTCGAGGTCGTGGATCCGGAATTGGAGCTGGTGGA
TCTCAGATCCAGCGAGC