Description :
From Genome Similarity Track
Location :
Scaffold_3777:89- 1884
Sequence
1795 bases(100 bases per row)
AGTTGGATCCAGGAAAAGGAACAGTCCCGTGTGATTGGTCTCACTTAGGTTCAGAGGAGGGATTTGATCCCAGCCCCCAGTTCCTCGAGGAAAACATTTG
TGAAGGGAGTCCGTATAGAGCGGATCCTCAAAAGCACAAAACGAGGAAGCGTGGATCTTGGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTG
AGTCGGGAGGATACTAAATCCCTACAGTATTATCGCTACGGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAA
CGAGGATCGGGATGGATTGATGAGACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCATGCTAGCCTGGAAGGCGGACATCAGGGT
ATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAG
GCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAA
GTCGTTCAAAGGAAACACAAAAATGTTGATTTGGGTGGACCTGTTTACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCT
GAATCGTACGAGGAGTGTGTCTTCCGAAGATTTGGAGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCTAGCATTCA
ACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACTATCACGAGAGCACTCAA
GATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATACC
CCATTTTACTTGGTACATGGGGTGGGATCCCCAAATCTATCCTGGAAGCGGTCATCCCAGTATGCAGCACCAAGAAGAGAACCCGAGATCCAAGGCGATG
GCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAGCGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGATACAACGAAGAC
GCCCGTCCACATCAAATCCAGGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCTCAAATTGGCCCATCTATGGCATGGAC
CGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACCGTATCCAAGCTGAAG
TTGGTCAAAGAATATACGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGGAGATAGTTGGA
ATGTGGATATCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGT
GTATTGGCGTGGATATGACGAACCCAGTAAGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAAC
AGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGAGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACA