Description :
From Genome Similarity Track
Location :
Scaffold_261:8899- 9929
Transcript NameFunction/comments
Phyke_g7456hypothetical protein PHYSODRAFT_504339

Sequence
1030 bases(100 bases per row)
CCCGAGGAAACACGCTCTTCGTTAAACGACGAGTGTCCTGCCGAACTCGGGATTCTGCTGCCCCGCCCCGGGCTATACCTACCACCTTCACCTTGCACAG
GTCgaccttcatcttcaactgGAGAGATGGTCTGAAGCTGCCGCGACCGACCAGCTCGATTTTTGCGCCATTGGTGCTTTTGACCAAGCACAGTATACTT
CTGCTCCACTCGAGACCCGACAAACATGTCCTGTTCCTGGTTGGAGTTTCTGTCTGCGTTAAAGAGCTGTCCGACACCAAACCGACTCAGCATGGAGCTG
GTAGGCCCGGCATCATTGGACTGGGTAGCACTTTTACGCTGCAATTGGTATTCTGCATCTTCGGGGGAATCATGAATTTTCAACGCCACAGCTTCGCCAC
GCATAGCGGCTACGGTATCGTTCCCATTATTAGAGTTGTGCCTCAGAGAGCCAAAAcctttgccttcttcaccgctTGATGGGTTTCCCTGTTCAAAATC
ATCCATGTCTTCTACACCTGGTGAAACCACTGCTACGCTTTTCGTTTTTGGGTAGTTGCTGCCGTAGAGACTACGAAGAGCCGTCCTGTGCATGTTCAGC
GGCTGCAAGCCCCGGATGTTACACAACTGAAGCGCTCTGAGAGTCTGCCGATCAGGACGTGGGTTTCTCTCGCCTTGGATGAATGATTAGCACTATTCTT
AGTGATCCCATACCTGGATCAACGATATAACTTGTTCACAAAGTATGTCTGTATATTCAGGAAATAGACGACAACAATTACAGCCGGCGCCTGAATAACT
TGTACACAGCGCTCCAAGGGAACTACACAAGCATTCATAGATTAGGGAACCAGACGACTCTCAAATTGGCAGCGATCTCGACGAATCAGTTGAGTCTGTC
GAGAAGCTAGATGATCCCCAGCGTGACCATCTCGACGATCGGGACGAGCGTTTGATGCTATTTGTTTTGCACGACACGCACACACCGACGGTTGTATATC
TGGCCCCGGGCACATCTACAGTCTCGGCGT