Description :
From Genome Similarity Track
Location :
Scaffold_20:88988- 89992
Sequence
1004 bases(100 bases per row)
CAGCGTCCATCGCCGAGAAGTCGTCGCGCCGTACGGGCATCGACTTCAGTAGTGCCGAGTGGCACTACCGGACCGGTGGTTTAAGTCCACGGCCGAGATT
GTGGCCAGCTGGAGGTTGCTATAAGCACCTCCTGTGTGGGTAACCAAGTTCCACGCGGAGTTGATAAGACTCCTGGCACCACCATCAAGACGTGGGTAAC
TTAGTTCCATGTCCTGATCACCGCCGACGACACCGTCGCCGCCGAAAGTCGGGTCTGGGCACGTACCAGACCGGAGTCGCAATGAACGACTCGAAGCTAT
GCTCCTCAGACACGGTCGGCTCGATGATGCAGCCAGTTATCAGCTGCTACCACAGGCCGAAGTGTCAGCATTGCTGTATGCCGAAGCGCAAGCTGCGCTT
GGGTTCCGAAGAACCCAGTGTTTCACTTCATGGCACGAGTCACATGGTTGACGTCGTGCCTGGTGCAATGTATATCGCGCCCGGTCGCCCAGACCTTAAC
TGAAGAGGAAGACGCGGGTTGCGCTTCCTGTGTGGGTAACATAGTTCCACATACCAGTCACGGAAGAGGTGAGCCCATGGTGGCTTCACCCGACGTGGGT
AACATCGTTCCCCAAGTCAAGTCGCACAGACTCAAACTGTTCCCGGGCTGGAAGAATTCCAGCCGCGGTTGACCCGGTTATCCCGGAGGGGGATCGATCG
TAAGAGGGGGAGGTGTTTGGAAATTCCTCTCCTCCCAAGTCTCTAAGGGGACTAGCTTCCTCACGGAAGCTGTTGGTGGCATGAGCCAACAACTGTACTG
CATCAGAGCTGCACGCTTGCGGCACTTGAGGCAGCCGTGGTACATTGAGCACGCGGCGTACCTCTGGTGTACGGGAGCACAGCCCCGTACGCCGACGCGG
TCACATGTGGTGATGAGTACCGTGCATGCTTGCACGCACTCGGAACATCTCAATGTTCTAGTGGTAGCCGTAGTACACGGCGAACCACTAGCGTATGAGC
TCAC