Description :
From Genome Similarity Track
Location :
Scaffold_6:889712- 894355
Transcript NameFunction/comments
g1107.t1hypothetical protein
g1108.t1hypothetical protein

Sequence
4643 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAATGGATATATTCAGGTTGACCACTCCACAGGGTGGTCCACATTCATAACAAAAACATATGACTGGTAGAAA
GTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGTAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAA
CCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACT
TAAGTTAAATACATCTACGCTTCCTCCTACACGTGCGCACACGTATAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTAACATTCACTCGTGAAGGCACA
GATGTGAAAAGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAA
CCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGGTCGACGATACGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCG
GACGAGCAAGGAGTTGGGCGTACGGACGCCGACTCACGGACCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAAGTAGCGTTTGAGCC
CCCGCAGAACGAGTTCCGATCGAGGGTGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCG
AACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGTCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATC
CAAATACTCTCGAGGCTGCAATTGCGCTCGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACC
GGTGGTAAGGCCGTCGGGAGGTCCCGAAGCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTC
CGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGTGATACTGGGTATCGTCACGGGCAATCAA
AAAACTAGAGGGACCAGCAGGTGCGGGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCGCCCAGTGAG
AGTCAATATCACTGCAAGAAACAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTG
GTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAATTGAGGCTAGCAACGGG
TGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATATG
GTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCAGCAGCAGCGCGA
CAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCAACAGAGGCAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAA
GCGAACGACAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAAACGAATCAGCAGGGCCTAATTCAATCGGATTCGAGAGGGTCTCGAAGCGTCCGGGGC
GACGCGGTCGTGTCGACAGATAATGTCGATACACAATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGGCGTGTCGACTCTGGGAGCCG
ACGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGATCAAGCCGGGCGTGAACGCGTGCGCCGGCGGGAAGAACCCGCCGGCGAAT
ACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGCAAAGCTGCGCAA
GTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACAACCGTCGAGACACTGAGTGTCTTGAAGCGTACGAGT
ATTGGTCTCCAATACAAGAAGATGAGGCTGGAGAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCG
AACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTAAATCAGCTCATCTCTGAGGGCGC
GGACGCCCTCAGCGCGAAGTCGAAGAAAGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGTGTGAGTACAAG
GATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGAC
AGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCACAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGC
GCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATTGTTCATGCGTGTAACAAGCTGAACGATGCGACGGTACCGGTACAGACGCCGATACCT
CGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATA
TTCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGTCTGAAGAACGCCCCAGCGATGTTCAACAGGTGCGT
CACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCCGGCTGTGAATGGGAGATCGGATGTGGAGATG
CATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTATGCAAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTAC
TTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGATCCAGGAAAGGTCAGAGTGATCAATAAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCA
GTTCCTTGGACTCGTCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAGGCTGCATGGGAA
TGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCTGTGTGATGCA
TCCGATTTCGCGATCGGATGCGCACTGATGCAACACGATCACGAAGGGCGTGATCGTGTGGTTAACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCA
ATTACCCGGTACATGACAAGGCACTCCTTGCCATGAAGTATGCACTCGCAACGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGA
CCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTATTTGCGGAATACAACTTCCAGGTTGAGTAC
AAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGCCAGGACGA
CCACACCCTCGTCGTCCTTGCTGGATGACGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAA
GTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCTCGTGTGCACCGTTATCGTGTACACACTGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGAT
CGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCAGGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACT
TGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTTCTTGCGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAA
CTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAGCAAGCGGAGG
ACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCG
ACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTC