Description :
From Genome Similarity Track
Location :
Scaffold_1024:8897- 10648
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1024-abinit-gene-0.10SET binding factor 2 (LOC559753), mRNA

Sequence
1751 bases(100 bases per row)
TATAAATCGGTTTTCCGAAACTCGGGGAATTTCTCCATCAGTACGCGCTTTACTTTGGTCGCGACGCGGTCAAACGTACGCAGCGCATCCTCTCCGCCCG
TCGCGAGATCGCGCTTGATCGACCGCAGCAAGTCCGAGTCGACGAGGTCGGCGCCGATATGGAACTGNNNNNNNNNNNNNNNNNNNNNNNNNNGATTTCG
CCAGGTACTTCATAGCGATCTTGACACCGTACGTGCGAAGCATGAGCACATCGTCCTTGCTGAACGGCACGCTGTGGCCTGCAGGCGCGGGCTGGTTCTG
GTAATTCGCGCGCAACGTGCACCAAAACTGTCGGTATTCCTCAAACGAACACAAAAAAAACAGCTTGCTTTGGTCGGACACATCGAGCAGCCATGCGGCC
AAATACCGCATCATTCGCGGATTGCTCACGACTTCTTCAATCGAGATCAAGTTCGCTGGGTCCGGGGGCGCTGAGTTCTGGCCGATCAGGTATTCCTCTT
TAAACGCACGCTGCATGACTTTGCCAATGTTGTTTTGGTACTGGTTGTGCATCCAGCGGTTCCACTTCTGGAGTTTCGCGGCGCCGATCGCGGCACTCGC
AAACGACAAACTGTCGTTCGAGTGCAATTGCGACAAGATGATCTTTTGCTTGTTTGCCCACACTTGGGCGGCAGTCGACGGAGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTGTACCCGATGAAGAGGACGCACTAGAGGAGGTCGTGACCGTCGTGGTCGTCGGCGTCGCCGCTGACGCTCCATTCGTGCCC
TTGCCTGCCATGGTCGCGAGCAAGAAGTTTCGCGCTTTGAGCTTCACGTGTTGCGCCCATCGAGATTTCGCGTTCTCGATCTTCACGTCCTCCTCTTCCT
CTTTGATGCTCGTCACTTCGATGCTCTTGGTGTCCTCGTCCGTTGCGCTCAGTACCTCGGAGACTTCACGCACTGAGAGCTCACGCTCGGGTTCGAAAAG
CTCTGTCTCCATCAGCATTTGCTCTGATATCGTGCTTCGTCGGAACGTACTGCGGCTGGAAAACGAAAACGCAAAGCTATCGGACCGCGAGAACGCCATA
CTGTCGCCGCGCCCGTGCATGAGGAAATCGTCCTTGTCTGTGTAAATCGCCGTGCTGCGCGCGCTCGCCATGCTCTCGCGGATCACATCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGCGGAAATCGTGCTGTCGGGAGGAATCTGCGGGCCTTTTGCTAAAGATGCTACGTCCACAGCACGCACACAGTAA
GTCAGTCTGCCATTCCCATAAAAAAAATTAAGCAATAAAACAAANNNNNNNNNNAGTACGTACAATAGCGGCCACTGCTGGAGAGACTAGATGTGGACTC
ACTGAACGTGCCTCGCGCCGCCGAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCCGAGTCGATGTCCATCATGAGGAAATTCGCA
TGGTTGCTGCGCACAGCCGACGACGACAGCAAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGCCGCGCGCACTGCTGCTGTTGCGGTGCGTACTCGGTGTATCGGCAGAGAC
GCTGCGACTGAGCACTGCGGTCTCGGGGATGCCTAGCATGGTCGGGTGCAG