Description :
From Genome Similarity Track
Location :
Scaffold_6:889597- 895526
Sequence
5929 bases(100 bases per row)
AGCAGCTTCTTCACCACATCCTCCCAGGCAACCCGATAGTTCAGCCACTCATCTAGCCCCTTAATCCCCGCGGCTAAGAACGCAGAGACATCATATCCAA
AGGTTTCATAGTGGCTGTCGAGAATGTCGTTGTATGTCTTGTTGGATGGTAGCGTCATGTCTGGATCCCCCGTGAGAGTGTGTACCATTTCACGGAGCGC
CGCAGCTGTCGAAGTATTGTATGGTAAGCCTAAGTACACATAAGTTTGTGCACTATATTCCACAGAGTTTCGTACGAGCTCGCTGGAGGAACATGTGCAA
TATCTTTTGGTACTCTATTCAGGACTTCGTGTTTATCCTCGAGCTCTTTTTCACCCTGTGCACGGTCGATTACGGTGGCTTGACTACATGTCAATTAGCA
GCTGGGCGTAAGCTCCTCCATGTCAGCGTCCTCTCCGTTGAAGAGCTATTTCACGCACTTGGAGCTGCAGAACCTGCTCCCATTCAATGCTAGCATTACA
GTAGCGTTTATGGAGCTCATTGCATCAAGTCACATCTTGCTGAGGTCAGTGTTCTTCGTGCGCAGCTCGTTACTGCACAAAAATTGACTAAGGCGACCGC
ACACACAACACGGGGGCGTTTCCGGCGCGTATTGCCTGCAGCATTCTACATTAGCACACCGCATCAGTTGTGGCTTTTGCTATGCGAATCTAGAAGTGGG
GAGAAGGAAAAAGAGGGAGGCAGTTGCGTGCGAGCTTGAAGGACTTCAATGGGTTCACGGCTATAGTCGTTATATTAGTGCTATTATATCGCTACTAATC
TCCATTTTATGTGTATAGCGCTACTAATGTGATTTGCTTAGTGCTATAGTAGAAGTAATATGCAAATTTTTACTGCTATCACTACTATTATCAATATGCT
GGAGGCTACTACCGAACCCTGGTTGCAGGGTCAACTTAGGACGCTGACGCTGATCCCGTCTCCGCGTGCAACGGCAACTACGATGGCTCGAGTAACTCGA
CTTCAAAGGCCATCACGTGCTCCGAACCGTGGGCTTACGGCATCTCCTCGAGCGTTAAGAATGCGGTGGAAATGATCCAACCCTTCGGTTCTGACAAGTA
TATGGTAGCAAAAGCAGTGTCGTCTTGAAACGCCTTTGAAAGGGCTACGACTGGATTGATTCACTCCGCTTGGCTGGGTGCGCTCAGGGGATGCCTGAAA
GGTGCAGTGGGTGAGAACCACTGGATGTACTCACTGATCCACGATTTTGAAACGCTACGCAGGCGTTTCCTCAACCAGGCATTTGTCAGACGCCTCTACA
GATGATTGAGAGGTTGAAGAACGCCAAACGCAAGGAAGGAATGTCCGCCTATGTGTGGAGCGACTTAGTATCGAGTCTTTGTGACGCGGCAAAATGCACG
TATCCGCAGATGTGATGCCAGTACTTCGTAGCGGGTCTTCGCAACAGGGAGTGGAAGACTTTGCCGGCAACGTTAAATGTGAACACGATCCCTCAGGCTG
TACAAGACGAGGACTCTGAGTTCGTCGACGAGGCCAAGACCAAACCCAGTACGAAAAACACGATGACGCAGCAGGTGCTGAAAATGATGCAGCAGACACA
TACCACGTTGGTATAGCAGCAGATGCAACAGATGGATCGACCGTCTAAGGTCGTGATCCGAAGCCGGGCTATGCGAGGGCTACGTCTGAAGACCAGTCGC
GCAATTCTCCGCGGTGCCAGAGAACGCTTTAAATGCGCTTGGAAGCAGCAGGCGCATGGGTCCGGACAAGTACACCCAGAACGGTATAAGCGTGTGCGGT
CGTTGTAACATGCTGCGCTGTAAGCACGAGACGTGTAGATATATCAACATGAGTTCTCACAGCCGCAAGCAGTGAGGACACGTGGTCTTTGAGTGCGGAC
TTCCGGCGCAGTAGAATAGTCTTACCCAACACAGCACGAGTGGCTACAATGGGCAACGCCAGAACGGGAATGGCTACCAGCAGAGTGACTAATCTTCTGC
GACAGGCGGGACCACCGCATCGCTGACCGTCCTGCAAGGAACGCGATGGTCAGAATGGCCGATCAGATCGTGGCTGAACCGGCGCCCGTACACGGTACCG
TGGTCTCTCAGCCTTGATGGGGGGCAGGGGGTAGGGGAAGGAAATGTCACGCCTTCCCATGTTAATGGAATGGCAAGAATGAGACCGCTCTAGAGTCCGC
GATTGTGGCGGATGGCGAGTTTGGAGGGTTCCCCAGAATCGGTGGAGCTACGATGGCTCTGATGATGAATGACGCGACTAAATACTGTGTGAATTTGATG
GTAAACGAGGAGGATAGTGCATATCCGCTTCTAGTTTGACGTGGGTATAGTGGACCACGAGGAAAGGGTCCCAGTGGTTGAGTTGTACTCTGTGGATGCG
CGCAGATTGAAGAATAAGTTAGACTTCTGTTCGGTATGCCATAATGTAAACATTACGGAAAATGGATACGATTACGCTGTCCACAGGCTATTCAGACGGG
ATACACACCAGAGGCGACAGGTCCCATGAGAATCGGTGTCGTCCGTCCTACCGAAGAAACAGTACGAGACAGCTAGTTGCAGCATACGCATACCAGAGGG
CCGATATGGATTATGTTGAAGCGCAAGTGATGACAGGGCACAAAGAGATGGGGGAAGCGACGAGACCGGAGTGTCGAGAGAAGCGGGTAGTAGTGACCGC
AGAGGGTTCTGCAGGGATGCCGGAACTGAATGCCGCAGTGGCCTTGATTTTGGTGCTGCGGCGCAGCCGACGTAATTGAAGATGGAGACGGAGAAGGAAC
CGTCCACAGTGATGAAGTGAAGTGTGGCTGCTATGACGAGTTGGTAAAACGCTCTACCAGCTGGTTCTCAGATGGCGAGTGGATAGTGGAGCTCCCACAA
TTGCCCCCCCCCCGATCGGGAACGATCGACGTCGAAAGAGCAATTCTGACCGACGTACAGTTGGGCGAATAATCCGTGAGTTGTAGATAGCACGGGAGCC
ACACTCAACAGCCGAAAATATAACCGTATCCAGGAATGCTCGATCTCCGACTTGGCAATTCACAGGACAGGCAGGTGGACATACTCAATGATAATTCCCG
TAGCAGGTGAGCAGAAGCATCGCCAACTAAAGTTACGGCGCTGGGCAATAGCGATGCTGAAGAGCTCGCCGCGGTTGGACATAGGGCAATCCATGCTGGT
CAACCCGGCCTTACGCTTACGAAATCAACCAAAACTCATCAACCCCTACAACTGGAGTTGTATAAGCCAGGCAAGAGCCATCGGAGTGTCGACGGATAAT
GCAGCTGGAGGGGCATGCACCATCCAACTCGAGCAACAACCCAACGGCATACATTGGAGTGTAGTCGAGAGCCCCGCGACAGCGGAAGAGGCGCACCCGG
ATATCCAGGTGCTTCAGCACAGCCAGGATGACGGCGGCATCGTTTTCGAGGCACACCCCTCGATCCATGGCATACAATGGGAGGTGCCGGCGACAATTGC
TAGCAAGAGAGTGATGTCAGCTATAAACAAGCAACCATTCAGACGCTACCAAGTGGCAGAGAAAGGATTAAAGACTCAAGTGGAAGGACTGGAGGTACGG
AGGAGAACCGACGAGTGGCAATGCGGGGCCCTAAGCCAACTACCGAAGCAGCTCTGGACCCATGGTAACGAACTAACGGTGTACCAAGTTTGGGTGGCGT
ACCGGGTCGCTGTGGCACAGCTAAATTGCTTCCACGAAGGCCGACTAATTGATAATAGCTGCCGGAAGTTGCCAGAGTGTCATGAAGTGAAGGAGACCCT
AGCGCACATCTTCAGGGAATGCTCATGTGCGCAGGTGTGCTGGTCCAAGCTAATCAGCCATTGGACGGGTGATCACAGAGAAAGCATTCGTCGCGAACAG
TACCGCAGCAATTGCGCGGCCAGGAAAGTACCGGCGTTAAATACGCCCAGAGTGAGAAGCATCATAGCAGCTCATCCGGATGACGAGAAGCTCTACCGAG
CAGATTGGACGGGGATCTGGCGTATTCTATCCAGTGTATGCATTACCACGCTGTGGATCCAAAGGAATCGGGTCGTATTTCAGCACGAGGAGACATCTAT
TGAAGGCATCGTACAAGAGTTTTGGACAACCGGACTCAGGCAGCTAAAGGCGCTCGCGAAACGCGAGCGCCGCTCACCAGAACGGATGGAGCAAGGTACA
CGACTACAGGGATGTATCAATACACTGGAAGACGAACCAAGAGAGCAGTCACACGAGCTGACAAGCCTCGCACAACCACCGGATCTAGCGCACACACCGG
CGTTGCTAACCAGGCTTAGGATTTACCAGACATCTAGAAACTAAAGTTAAATAGATAAGCCTGCCTCTCTCTCTAAGTGTGGCTGCTACGACAAGATCAT
CTGGGACGACCAAGAGTACTTGAACGCTGTCAGAGCAGCTAACAGTAGCTTGTGGGACCCCCATCTATCCCTGCCCCATGAAGAAAGAGATCGTATATGA
GGACTTAAGATTGATGCCAAGCAACGACCGATGTGATATCCCGAGACAATCGGAGAGCGAAATGAATTTGGACGAAGAGTCGATGTCGGAGAAGGTAAGT
GCGCTGGGAAAGTCAGGGTATGATAAAGAGCGGTGAGTCTCCCTAGGAAAGTGAAGAGTACGGGGCGGTCGGAGCCGTGGAGGCTGTCTGGAATGATAGC
TTGACGATGAATGGTCCCAACAAGGCCGTCGTAAATGATTGAGCGAGGAAATGAGAATGGGGAGACAGCAGCAAGACATCTGCAGACTTTTGTGCGTGGG
CGTCTGGCTGCTCGACGCCTGCGGGCACACTCTCGCGCCGAATTTGACCAGAAACTGGGCGATATCGCGAAGCTGAAGGTTATTTTGCAACTTCCCAGTT
TACCGCTGCCCTACGACGCGCTGTTTGAGGTGATAAGCCACAGAAATGGAGTCATTTGAGCTTCGTACGGGTTGTTGAAGACGCTAACTAAAGACGTTGT
GATTGTTTATTGTAGCTGCTGCGTTCACCAAAGACGCCGTTACCGGTGTGGAACCTGCGCGCCCTGAAAACCCCGTCTCAAAGAAGGGTATCGTGGGAAC
ATCAGCTCAAGAAGTAGATTCAAGAGGGATCTGAGCTAAGAAAGTTGACGATATGGTAAAATCGTCGCATGAAAAGTTGCATACTGAGAGGGAGCTGGGC
CTGGTGGTGGAGGGATCAGCGGTGGAAGCCAGCGAGGAGAAAGAAGAGTACGGTAAAGTGATCGAAGAACGACTGTACCCGCTGGACGAGGTCGAGCTAA
GAAGAAAGATTAAAGCTATCGAAGAAGAACCGCGAGGTCTTACGTTAGACAAGATTAGTATGCTTCTGGGAATTCAAGTAACAACGCTGGCTAGGACGAA
GGAGTCGTCACCTGGCGAGCAGTCCTCGCCAAAATATTGACTAACCTGGTATAAAAAGCCTCTGAGGGCCCTGTGAGAAGCCAGATGAGCTAGCAGTTAC
TTTTCAGAGGGTCAGCATGGGTCAGAGAAAGCACCAGGTGTTGGAATAACTTGCGGTCCCGATTCGGACGAAAGGGATGTGGGTGGTGGGGTTTTTGCCG
TTTGTAAAAGCATGAAGGCGCCGGTATAAGAGTTGAAGAGCCGATTCGTGCGTGGTGGATAAGTGGTAGAACATCGGTGTGGATGTGAGTGGCGTCATCG
AGTCAAACCTGGACGGTACCCAAGATGTAAACGTGGACCCCGTCGTTCAGTGTGTTGTCCTCGAGCAGTCACATGCTGATACGGTGGACAGTGCACTTCT
TAGTAAGATATGACGTCGTGGGTACCGCTCCAGGGTGTGCCGCGTGCCGATCACACGCTCAGCGTGGGGGGGGGGGCTCGTTAGGATTACCTGGACGCTC
GACCGGGAGCTAAGATCAGAAAGCTGAGT