Description :
From Genome Similarity Track
Location :
Scaffold_81:88956- 95603
Transcript NameFunction/comments
Phyca_LT1534575955callose synthase putative

Sequence
6647 bases(100 bases per row)
ttggccgcctgcattcgacttggaccgcacacggctcatgttgcgttgacgagctgtacccggagtccgtgtgttgcggcttgcgcgctcggcacgcatg
cgagcaatgcgatcgcggtccttctgtgcttccgatttggtacagatgacaccattcttcttggtacctgcgcccaataacaggaccagcgtgatgacac
tgaaacctgcgattgcgtacagataaaagtactcgttctccatcattgagtcgtgcgtatgcatgtaaacgtagcccaggtctgccaagaaaaagatggc
aaacaacatggtagttgacgaggcacgaccacttgtggtgaacatgccaacgcaagctgaccaaggagcagagctcgtaccgagtcccatgaagaagtac
atgagcatcacaaccaggctgacgtacaggccagaaccctcagactcgcccaagaaatcggacgtctcgttgaagcccaacacaccagcacaaatcgcga
tcggaatcagagttccaaacaggaccgacttgtgatccagcttgtcaataaagaagaaggcaatcaccgcacccgagatctgcagcgccatcgcgttcac
gaacagcttatcttggtcggtgtactcgctggcacccttgtagctaacaaaagcgttcaagaagcccgttgttaacgaagttacgagcatcaggaacaga
ccaataaggaacttgaaaggaccagcacctccctcgtctgcagtttcctcttcacgcataatcttgagttcttcttgacatcaggcttacgacgcagaat
gaccaagcaggcctcacacgcatcccaacccttgcgctccagaacccagtaggggctctcgggaaacacgttgaccaccggagttactaaagcgattatg
atgcaagcagcaaatgtttgccagatccatcccaactggttcaccgtcgcgaaaataccacccaacaagctacctgcgatgaagcccatgcccagaagca
acatagccttaccacgcatttccttggtggaaatctcgaagatataaatcgccagtgacggaagcaggataccacaggatgcaccaagaaggccgatacc
aggcattaaaagagtcgaacgaaggtcatcattggcgctgacagccaccataccgagagtgctaaagagaccaccagccacgatagacagacgacgaccc
aggaagtagttcaagaagcctgagatgatcgtgcccacgacacaagcgccgtatagcatgtacgtcgtagtaccgtcgccgacatttccacttagaacac
catcgtacgtcacgacataactcgcaaaacttgcagactgctccaacgtcgacagcaggttaaatagccagccaactccaacaccgccgagaacacccat
gaaggcagcaagcgagaacgcatactgcgacgaagcggacatgaccttcgagaaaccttcgttgtacatcatacgcgtctgaataacgttcaagaacggg
atgcacgacaaaaccaccagcgggataatcattcccgtgcagaagatgaagtcgaaaagaaattgcagctgctggaacacagcgatgcctgcgatggaag
agtgtgggaagctccacatgcggaagcactcgttgatgccatacagagcagctacatacgcgaagaacagcgagatagagtacttaaaagtccagtccat
cacgatccacgtagcgagaaagtatgcagtcaccaagatcgccatagtgccgaagtaaataacagcacgcgttacagggctcatggagcgcatacccata
ccaataccgtggaaaaaaccgagaaggataatcgtcgccacagctgcgccaaatgagtacgcaacgtacatgacatcagacgtctccagtgtggccacgt
aaaacataagcaggaagtgacggcattcgcgaagaataaccgtgacgcgcgaaatcatgttcgagttgtgaagctgctcgaggtctcccttccaccagcc
aacccagccacccttgttggccggatcgtcatccttgtaatcttccggcgcaaacatccacatgcaccactgctggatatccaccttcgttttcctaagg
tcgagaccgtcactgttaaacatgaacggaccaactacccacaaaattgaaatgaaccacacggagaacgtctgcacaccgtaagcctgagcagtatcac
agtagtcggatgcaaatgtgttgtcgttggcagacgcatcagtctgacagatgtagaagttaccgaacaccaggtacaccagacacaaaccgatcagctc
ccaagcctttcgataatgtgaacttgcgtaagctttatacagcagcaccaacgtttcacgagaaattttgaaaccacgacccgtagcctggtacttggca
ccaccgtgcacaatattgttatcgaagtagtgcatcgtcgtaccgacctggaacacgaagaaggcaggaccaagcgtgataatcatatcgatgaaacgcg
tcataccgcgcacaaaaccaccttcaccgaagtacacacacatcagcggaagcatcaagaaggtaccagcttggatgtagaactgtgtgttcagcacagc
cttcaggtccgtgaatacacgttcgtcgaagttgttggcaatattgctagtgatgacagcagtcgagttcatgtcgtaaacaatttgctgctgaacacca
gccagggccaggtacaccttgcagtacatgtacacgaaagttgtcacaatagtcatccaggtagcgaaatagaaccccgtgtgtgagtagtacatcgagt
tcagacggaagaagtccataaactggcccatgcggtgagcctcacgtgccagggaggtttcaccggcaccatttgccagcttaccttcgaacatggaaat
ctgcgaaagagccacatcacgacccttaccacactgcataaactccacgtgcgtcaccacaccgccacgaagggtagagttaaaacctgcgaacacatcc
tcagacaagttaatgcccttagaagccttggacacaccaccacgaggaatggcaatgattttgtcgaaaatatcagggtgaccatagtgcatacgcacgt
acagtggatcagctagcacacgttgagatagcgtcacgaacacaagctcctgccacgatttaaacttcgacagagacgaagcattacccgtgaaaatatg
ttcacgcataccaataatcgagacaggtttcttcgaagggtgcaagtctgcggtaacgagtagctgaggcatctttagacattcctcgaagtagtgctgc
tggttcatatcaatcgtctgcaggtattcaccacgcgtaaacggaagagcgttgttctggttctccggtttaccttcaccaagaatcgggtcaccaggca
gttcgtaacggtacacttcggcaatttcgttgccttcactcttgataagcacagtatcgaactgtttgccagcgtcgctcgcgatggtgtcgacgtaggc
aacacgcaagttcgggtacgtcttaagcaggtagtcgatatcatcggcttggggcttgttttctgcacgatgctttccgtacacctgacaagcacaaatg
tacgagaatttcaaacgcaccatgtcttcaagctgggcttgcttctgctcagcagtcttgccaggactcgaaccaatttccagccagtgtagaatcttaa
tagcatcctcatagagcatcataccctgaacagtacgagccaacgtctgaccacggtacgaagcccatagacgaatttctagcgggtagtttgcctgggc
ttcttctgcagtgctcacatcaatacgctccaaaaagttctcccactcctcagggtggatcgtaatcaggtacttcagaatggtaatgttcttgcccttc
tcctccaccttttggaagacggggtggtttaccagtgggtcgttcagctccgacagagagataaggacactttcactgtagaacggagtcacaacggaga
acgagtgcatttccttgactgacgtcagctgtgggatgtccatcacaagagacttcataaagaaaccaagacgtcgctgagcctcaggcacgcggggcat
agcatcagccttttcaagcgacatcagcaagtacgcgcgcgtagcggcacccatggcggtgtcgttgtggaacaggttcaccaaaccacgagcggcaaat
acgtagccgtttgcactggagcaaaacttagagttgctgaacttggcagcaagttcagggcggttcgcgaagatacgaacggcgttaaggaggttctcca
ttttagtcacgaagttacgaacaacacccatggtgtgcacacgtgacgtcgtcaggtgggatgactgggcatccggatcaggcaaatccatcacagcctc
caagaactccatcgatacagtacgcaattgtactaggctctttgcatcaaacgtgctcatgaagctaccatttgcagcaatcgtctccatttgacgaagc
gcgtcgagaatgtcggcgtcgtcacttccgaggagggcctccatcacgtacatactggccgtgaagaaactgcgaacagctgacagacagtccttctgca
ccatgtacacctgaagctgcgaatcaccttttccttccttggccaacttcaccgtgtactccagagcttccaccaacttaccagcagacaggaacacggg
ctcgaaaacgtcgcccgaactctgaatatcgtattgcaagattgcagcttccttgtcgtctactagatcaccctcgcggaacgagtttacgatctcattc
cagacgaccacgaaacgcagcatcatttgcgactgatatgctgcagcggaaccatctgcagcagcatcattcgagcgagctaggttggttaccaccttct
ggtcgaaaagttggggcgctacacggaaagccttggttatctccttgatgccatggatttcaccggtcttcatgatgagaccctgaataccaccaagcgt
agcctggaacacagtaaagtaaatctgggtatcatagttgaagataaaaatcacaggaagccacagcgccgcgatcacaccaaagttgtggaacgacacg
acgttgcttccgtactccagctccatttcgtagatggcaagcgacgggagaaccaatggacgcaccaaaatgaagtacgagatgaatgccttcagggccc
aaagaatcagccaataggtgatgtacttcatctggtaactcaacggtggagccatgttgcgtcccacgtaacacgtttcaccctcacggatgaacttggc
cgcaaacgtttttgtaatcatcgtcggggaaaacgcctgcacgacaatgatcagtgcacctggcagaatgtaagcaacagacgccggggcagccttgtcg
agcagctcagtgttcttgctcgtaatcagcggtgtgtagatcattaaaccgaagattccggcaaacgcaccattccagagcatacgaaccacaagagcac
caccgtagttgaacgaacgtgaggacgtctcagacgactcactagcagtgagcaagtgccaaccgtgacaggcttccagcacagtcttgcagaatcccat
cgacgacagtgcaaatacaatacccacgtaggtgagcttgacgtcctgcttctggtagggctccacgacttctcccatcgaaccgaattgagcgaaccac
tgctgtccgccactaggcgagatggcagagatgaatgcgatggccatgagcaccatcatgaacatcatgttgaactggaaaatgcggtagtagttaagca
cgagcgtaaagatactacgatgttcgtagtaggtcttggtgtgtttcttcgtcagctcctctccaatgtgcgtaatgtcgatattaagacaatacttttt
ccaaaagtactcgttaatgtcatcgtagtttcgtacttgcgtgtgctccaagtttttgccgagactgttcttcctctgcatgttcgaggcttccttccag
atcggacgcaccacctgccgcaaataccatccttctggcactttctgctgtccgaggaagtcctggttgagcatgttcagcgcctgatgataaaggtagc
acaaacactcgggcatgtgcctcaagttaccagcctctccccacagcagcaaaaacagcataatgtccatgtgcaacgggttcttcagatctccctgtgg
ttgtcctgagtacgtggtgctaggcacgccaataaactggcaccaatcagtgtaattgctcatgagctttttgtgcaacgtaacgacatgatgtccaggc
gggtcctgaggcttggctcgagcctttgaattggccaaaagcagcagcacgtgctctctctggttgtccacactgccggattggaagccgaacttgttgt
agagcacttcacagcagaaatcgattgatacttcgtccgcaaagtcgccctggaggcctccgcctcgcatctggttgcctccctgcgtgttgggaggaag
aacgtccatcatactcagccgatcaccgaaagtgccgcggccatcgccgtagttgctgcggttgttggaagtgttgcgcttgcggtccgcgtccagctga
aagtaattggagccggcacggcgccgatccatcttaccaccgggcgt