Description :
From Genome Similarity Track
Location :
Scaffold_717:8895- 11566
Sequence
2671 bases(100 bases per row)
GGGCTGACTCACGAGCTGCCGTAGACATCGCGCGCGCGTAAGACGCCGCCACTACGTAGTCTTCGCGTAATGCGAGGGCGAATGCTTCCTCGAGAGAGGA
AGGTTCCGCTCGGGTCAGGCAGTACCGTGTCATGCCTTCACGCATGCCAAATACGAATACATGGACCTGCGATGATGTGTCAATCGGATTTGTCACGATG
CTTGACGCGAGGTGGCGAGTCTTTTGAACGTAATCGCGCATAGTCATTTTACCTTGACGAAGGGCGAAGAACTCGGCACGCACGCGGGACTCGTCTTGAG
GGGGCTCGAACGCGAGCCTGAGATCTTTCTGGAGAGACTCCAGAGTGGGGAATGCGTCGTGATCAACGACAAGTTTACCGAGGGCCCATTCCTTGGCCTT
CCCGGACAACCGGGACAATAAGAAATTGACCTTTGACCCTTGCGCTTCGATCATTCTCGAAGCAATCGCGATGTCGACCTCGCGAAACCACCGGTTCAGC
GGGAGGCGATTCGCTCCTTCACCGGAGTAGGTAGACGTCTCTAGCTTCACGACATCATTTTTCGAGGAACGCGCGGGAGTTGTTGCTCGCCGATTCGCAT
CGGCTAGCTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTAGGTCCAGGGCAGCTTGCCCTGACCACTCAAATACACGTCAACTCCTTATT
GGTTGATTATGGGTCTGGCTCCCCAATATTTCAACCAATAAGGTGACGGCAGTTCAGCACACGCTACTCGTGTGCTGCTGCACCTACTTTTGTAATGCAA
ATCTACCTACTTATGTAATGGTGTGAACCACTACAAAGAACCTATAAAACTACCGACATATGTAACTTGGGAGGGCCCATTACAAAGTTGAAGAGGACCG
ACGAGTCCGCAACGTCAACGCACTCATAGATGTGGTGTACCCGGGCGTTGATACTGAGAATTTACCCGATGAATACTTCGTTGAGCGAGCCATACTAGCC
CCCACAAATGCAAGTGTTCGGCGTATCAGCGACATGGTTGCGGAACGGCTATCGGGTGAAACGAAGGAGTATCTCTCGGTGGACAGCCTCGAAGGTGTCG
CGAATGCAAATATGTTTGAGCAGGAGTTCTTAAACTCTCTTAACTTCTCCGGTATCCCTCCGCACAGGATTGTTCTGAAGGTTGGAACACCTATCATCAT
GATTAGAAACCTGAATAGCGACGCAGGACTTTGCAACGGAACACGGCTTCGGGTTGTGTCACTGCGCGAGAGAAGCATCGAGGCCAGCATTATGTCCGGG
CCGCTCAAGGGTAAGAAGGTGTTCATTCCTCGGATCGTCTTTTATAGTAAGGACGATGACAAGGAGTTCCCGTTCAAACTCAAGCGTAAGCAGTTCCCCG
TGGTTCCAGCGTTCGCCATGACTATCAACAAGGCCCAAGGACAATCGATCCACCACGTGGGTATATACTTGGAATCACCGGTCTTCGCACATGGGCAGCT
TTATGTGGCGTTGTCGAGAGTGACTTCGAGGAAGGCGATCAAGATTGCTGTAGATCCAGAGGCCATCGATGAGGACGGGAACGTACACACCAACAATATT
GTGTACAGGGAGATTTTTGGAACGCGGACCTGGTAGGTCACGTAATGCATATAATACAATTAGCTTTGATTTCGAAATGTTCTTTAATCCGCCGCAGCGC
AGCGGAGGCGATCAGCCCACACTACACCAACCAACCATGCCCTAGCGTCCGCGGAGCGGGCGCCCAGAGCGCTAGTCCGTCATCCCTGTACCCTGGATCC
AGGTCCCTCTATGCGGGATCCTCCCTCCTTGGATCCGAACTCGGAAGTATGGGATCCGGGGCACCTCGCGGTGGATCTTGACTTCTTGTTAGCCGTGGCT
ACTAGATCCACCTTCAGAGGACACCTACCATCATTCCCTCATAGGATCCACACTCGATCCGCTGGTACATAGTATATCCCATATCCACCTAAGTGAGTCC
AGGTAAGGGTGGATCCGAGATAAGTCTTGGTGGATCTTGCTTTCTCGTACATCGTTCATACCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGTCAT
GACTAATCCACCACAGGCAACTTGTACCCGTGCCAAACAACCCAAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAG
GCCCATTCTCTTATTTCTGAGAAAGCACTTCACCACAATCGCCTCCTGTACGTTGTCGGCGCTGCACAACA