Description :
From Genome Similarity Track
Location :
scaffold_63:88938- 94074
Transcript NameFunction/comments
g2516.t1 sphingomyelinase phosphodiesterase, putative
g2517.t1 hypothetical protein PHYSODRAFT_473082

Sequence
5136 bases(100 bases per row)
GGAGGGAACATATCAACAACCCAAAGTGTCGATTGGAAAGCGCTCTTCCAAGGAAGCACGGAGTACGGAGTCAATTCATTGAACACAACAGAGATTACCG
GCTTCGTGGAGCGTGCAGCAACGGACGCGGATCTGCTGGAACAATACTACTTCAACTCGAAGGCGCAGTCGCATCTTCAATCATCGTGTTTGGATGTCGC
GTGCCAAGCGGAATGGCTGTGTTCTCTTTATTGGTGGTCTTCAGTAGCAGATTTCAGCTCCTGTGTTTCATCTACTAAGGCATCGAAGTTGAAGGGTACA
TCGGTCATACAGCAGACAATTTCTTCGTCGGCCGGATCGCTGTTGTTAGCGACAACCGTCATTATCTTAGGTGGGATGGCTGCAACCGCATTTTTTGTGC
TGCTTGCTTCTAAAGTGTGTCGGCGTGGCGGTGACCAAGAGGCTACGAAGCTCTTGCAGCGCCAGAGAGTCCACTTTGCAGCGGTGGTGTGATGCTTTTT
GCCAGAAATACAACAAAAGTATTGTTTGAAAAAAAAAGAAGATGGCAATTATGGAGAGAACAGGATTACAATGAAAGAAAAGCTGCCACAAGATCTTTGA
TAGTACTTCGTGGAGCATGTGCAAAACTTACGTACCGTGGATGCAGCTCAATTGAAGCTTTGCAATCGAAGTGCCACTACGTTTGTCGTCGTAGCAGTCT
CTACAACTCCCTTTGTGTGCATGGCAACTTCAATATGGTTGCGACTAACTCCACGAACGCTCATCTCCTTCATACAGCAAAAATGTTAACCTAACGTAGA
TGCAGATACAGTACCACCAAACTACATGTACAGTAGAACACCAGGCAAGTACATGTACGATTCCACTGCCCCTTCGTGACCATGGTAACAGGAGCTTGCT
AGTTGACCCACCAATTGTCGATGTTGATGGTGGTTCTCCAATTGCTGTCGATTATGGAGTAAACGCTGCCGCTCTTGCCAGCTCGCACGGAAGCTACAAC
CTGCAGATCCACGGTCCGTTCTTGCCGAGCCATGGACGAGGCCATCTTCCTCAATGAACGTAGCGACCGCTGGGCACTGGGGTTGCAGCAGCAATTAACC
CTGCCATTGGAAAGCTCAAGGTGACCATGAAGCCGCCGACGTCGGATCTGCCTCGAATGCAACAGCACCAGGCGGAATCGGAAGGAAAAGGTTCATTGAC
GACATCCAGAGCACACGCACGTTGCACTTGTCCAGCGGGAAAAAGATTGGATGCATTACCCTAACGTGTGACCAACAAATCTTACCAAGTTCACCGCCGA
AAGTGAAGTTGTGGAAGAAGTTGTCGGCGTGACCCCGACAATCAATCCGGCAGACTTGCTGACGTCGCTTGCTGATGAACTTCATGAGCAACCACTCACA
AATTGCACTGCTGCTTCGCGGGAGCTCGACGTTATAAATCCAGTGGCGAAAGCTGGTCCAACGGATTATGATTGCCAAGGGGATCCGCCTGCCGCCGTCA
TGGCCAAAGCGACGCAATCCAGTTAACTTCAAGGTGCGGTTGTCTCTGTCTCGACGGCTGCTTCGCGAGAGATCAAAGCCGGTTTGCTTGTTGTTGGGAC
AAGCTCCAATCGTACCCGACACCAGTGTGCATTGCTGCACCATTTCGCTAGGAGCGCACGTTAAGTCCCCGTAGTTGACGATGTCGACGAGGCACTTGAG
GAAGATAATATCTTCATGACTGCAGGTAAACTAACAACTGCAACCAGCTGTGGTGGAACCGGATTCCTCTATCACGCTGCGGCGCTGCGCACGCATCAAT
GTTTACAACGCCAACCTGCTAGAAGGGACTATGGTAAGGAGAAAACGGAGTGCGCGAAGGGCGAACCAACAGTAAACTCACACTCGAATGATGCCACTGA
TGCTCCGTTAATCCGCCTTGCTGCAGTTGAGACGCCTACAGTCCCTTCTCATAGTCACTCAGTCAACTCGATGCGTGACGCGTAGGATTTCCCTATTTCC
CTACTGCACTGACCAGAGAACAACCTCGCCAAAAACGGAAGACGGCAACAGAGAGAGGTCCAGCACGTCGCTCACTCTAGTTTTTCGCATCAGTAGTCAA
CAGAGTCTAGTCGTCGACTTGAGCTGGCAACCATGGAGCCAACCGCTCTCCCCCAGCTATCATCCTACCTGCCCACGGCTTCTCTCGACACGCGCACCTC
AAGTATGAACACCACCGGCACCGCGGGGGTCAAGAAGCGGCGCAACAGCATTGAAGGCGCGTTCTCAGCTGTAAGCCCCGGCCCGCCGACGTCGCATCAG
TTCGAGAACGAACAGCTTAAGAGGAAACAGTCTCTGTCTGAATTAGCAGTAGAAGACAACAGTTCAAAGACAGCGTCGTTCTCACGACTCAGCTCTATTT
ATCAAGCTCACGAGCAGGGGAGTCCCCTAGTCATGTCCAAGGGGTTTTCATTTTCGTCTACATCTTCCTCCCAAGATGGCGACGTCGAGACAACCAGTTA
TTTCGCGTCACAGCCAGCCACCCCCCGTCGCGAGCGCACATCAAGGTACTTAAGCGAGGGCGACCGCCGAGAGATCATCACGCGGATCGATGCAGGCGAA
AAGCAGGTGGCATTGGCAAGGGAGTTCAGTGTCAGTCGTGCTGCGATCTGTAATCTTTACAAGAATCGGTGGGAGGTGCTAACGCGTGGAAGTCGTAACC
CGGAGTCCAAACACCCAAAGACGAAGCGAACGCGCAGCAAGAGGTCAAGTCCGCCGCGCCTGACGCCCCAGTCGGCTGCGAAGGAGGATAACACAGTTGA
ACAAGTACCCGAGCCGATTACAGTCTACCCCGACGTGTCCACGATAACAATTACCACGGATGAAAGTCCACGCGAAGATACTTCTTTTGAGGGGTATGCT
GAGTACCGGTCAAGGCACGATGGCGACGAATCAAAGCAAGACAACGGATTGCCATCGCCTGTGGTTCGAATGGACCTTGAAGATCACACCAGGCACCAAC
ATCAATTGGAGCGCCACAATCAGGATGAACGACCTCGTGACCAGCCGTCCTCTATTCAGGACAAGGCAAGTATCCCGGTGGAATCCCGATCATTTCTAGT
CCATGAGGCTTCTGCGTACTCGTATCCGTGCAGGAACTTGGTCGCGGCGCTTAGGGACGAAAGCATTGGAACTGTCGTGTTTCAACAGCGAGCCATGCGC
TTAGCGCGTCTTCTCGTCGAGGAGGCGCTAACCTGCTTGCGTCATGAGGACGTCCAGATCAAGAACCAGTTTGGAGACGTATGCCATGCAACCAGGTCTT
TAGATGAGCGAGACATCTTCGGAGTGTCGATGGAGAACAAGGGAATGTTATTGCTACGTGCCTTCTCCACGATCAGCCCGGCATCGCTCACGGGTGTGAT
CTCCATTGAGGCGGGAACTATAGGTGATAAGAGCTACAGCAGCATTATGGCGTCTACAATTCACGCGCAGCTCCCTCCTGTTAGTACTCGTCAGGTCGTA
CTACTCCTTGACATCGAGTGCGCCACAGGGAACGAAGCCTGTGCAGTGCTACAGCATCTCGTCCACGAGAGGCAGATACCCCCCAAGAGTATTTATTTCG
TGACCGTCATCAGCTCCTTCGAGGGTCTGCAGAATGTGTTCCAGCACTTCCCAGGTGAGTAGCATGGCTGAAAAAAAAAATATCTGACTAGAACGATATT
TGTTACTGATGTATCATTGCTTTTCACAGACGTCACGCTTATCGCCGGACAAGTGGACACCGTGCTAGATGCGAACCAGCGCATCAGACCAGGTATTGGA
GACTTCATGCAGCGCTACTGGAACGTCCACACCGATCCCAGTGCGCCGTAAAACGACTTCAAGGCCGTAACCCTATAAAATGCAATTAGGAAATCGAAAA
CCAAAGTCATGTATAGTAGAAATTCCTGAAAATCGGAATCCACGCATTCATTTTTTATTTTGCGTACAGTGAAACACGGATCGGAAATGGCGTTTTGACC
TGGACAACTTGTCGAACGTCAGTCACCACGATTCGACAAGGAAAGTGACGACCCTGGTCTGCGTGTTGCATGGAGTCATTCCCGATGCCATTCTTGAAGT
CAGCGTGCAGCCATCCTACAGCTCCTTGAACTGGTGCACGTCGATGCCCTCCTGTCCGCCCTCCAGCAGCGCCAACAAGGCACCCGCGAAGGTCTTGTAG
TCCGGGTGCTCGCGGTGCTTCGCCACGCTCTGTGTTCGCACAAGTGTACAAGCATTCGACCCAGCCAGATCGCCAGACAAACGGAAGAACACGGTTAGTT
AGCTCCTAACCAAAAGCACAGAAAATAAAGATAGCTGGCAAGTACGCACGCTCTCCTCGTCGTAGCGCTCGACGATCGTCCACTTGCGCGAATCGCTGGT
GCTCTGCAGCGGGTGCCACCCGAGGACGCTGGAATCCTTGGAGTAAGTCTGCGCAGCTTCAACGAGCTTGGCGCGTAGCTGGTCCTCGACGCCGTCCTTG
GCGTGCAGGTTGACGATAATGGTGAAGGCCATGGTGAAGGAGGAGTGTGGAGTGAAGGTGGTTGGGAAGTCGGAAGCGAATTCGAAAGTGAGAGAGAGAA
GCAGACGTCCTCCTAGCTGAACGACCTGCCGAGGTGTCGACACGATGGAGCTCGGGCGTTGATGCCTACGCCACTTGTGTTTGTGTCCATCTGGAGGGCT
CCTTCGAGGATACGTCACTTCAATCTGGTGCTTAGCCAGATTACGCGGGGAGAGCAGTTTGAGATTTTTGGTAATCGATCCTCTCATGCTTGCAGACGTA
CATACAATGTATACATTTCTATGAAAACTTGACGAATAACCTAGGCGTGGGCGTGGAAGCGCCTGCATGCGTACATGTAGCAGGATTTGCAAGACGGTCG
TGGTGACGATGTTGTCCTGGATATTTCTGTTGTGATTCATTATTTTGCTCTTGAGCTTCCCTGATTAAACGATTTTTAATCTTGACACAATAATCACGAT
GCTGGTGCTGATTCGCCCCAGCTTCTTGTCCACTAATTTAGAGGTTTCGCAATGTCGGAATTCGATCGACTACGATGGAATGGAAGGTGGGGTGTATTAC
CTTCCCTAACGACCCAGAAAACACCCGTCAGTTGGG